P. 1
Skolski Leksikon Biologije s Pitanjima Za Maturu i Prijemne

Skolski Leksikon Biologije s Pitanjima Za Maturu i Prijemne

|Views: 1,074|Likes:
Published by Maja Vrbanec

More info:

Published by: Maja Vrbanec on Feb 03, 2012
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

08/10/2013

pdf

text

original

Sections

  • PITANJA
  • ODGOVORI
  • DODATCI
  • DODATAK 1
  • DODATAK 2
  • DODATAK 3
  • DODATAK 4
  • DODATAK 5
  • DODATAK 6

ŠKOLSKI LEKSIKON BIOLOGIJE s pitanjima za maturu i prijemne

Nakladnik

HINUS Zagreb, Miramarska 13 b tel.: 615 41 96, tel./fax: 611 55 18 e-mail: hinus@zg.hinet.hr
Urednik

Hrvoje Zrnčić
Recenzenti

Prof.dr.sc. Mirjana Kalafatić Mirjana Martek, prof.

ISBN 978-953-6904-26-6

Copyright © Hrvoje Zrnčić

Knjigu možete besplatno preuzeti samo za osobnu upotrebu, a ne smijete je stavljati na druge mrežne stranice, umožavati ili je koristiti za bilo koju komercijalnu svrhu.

Sanda Ilić Lela Zadražil Ljubica Kostanić

BIOLOGIJE
s pitanjima za maturu i prijemne

LEKSIKON

ŠKOLSKI

HINUS

SADRŽAJ

PREDGOVOR ...........................................................................................7 LEKSIKON ...............................................................................................9 PITANJA ...............................................................................................159 ODGOVORI ..........................................................................................253 DODATCI .............................................................................................279 DODATAK 1 ...................................................................................281 DODATAK 2 ...................................................................................289 DODATAK 3 ...................................................................................295 DODATAK 4 ...................................................................................297 DODATAK 5 ...................................................................................299 DODATAK 6 ...................................................................................301

.

Ovdje treba posebno naglasiti da Leksikon omogućuje i brzo razjašnjenje zbog čega neki pretpostavljeni odgovor na zadatak koji se rješava nije točan. znači ispitaj i dolazi uz pojam o kojem treba potražiti dodatne informacije. ali isto tako i zašto neki drugi odgovor nije točan. Treći dio čine dodaci koji pojašnjavaju bilo pojmove sadržane u Leksikonu bilo rješenja zadataka s proteklih razredbenih ispita. i isp. . hormona i dr. Leksikon podrazumijeva abecedni poredak bioloških pojmova i njihovih sažetih opisa što omogućuje brzo snalaženje prilikom pripreme za polaganje razredbenih ispita. ona sadrži leksikon pojmova iz biologije koji će biti korisno štivo još dugo nakon polaganja razredbenih ispita. znači vidi i redovito dolazi ispred pojma o kojem treba pročitati osnovne informacije. U tekstu se rabe samo dvije uobičajene kratice: v. Zatim su tu i uobičajene kratice koje su vezane uz način uporabe. Prvi dio je leksikon pojmova iz biologije temeljen na srednjoškolskom gradivu. ovo će biti izuzetno korisna literatura. Kratica v. prije svega kratice naziva različitih kemijskih spojeva. Dvije su vrste kratica uporabljene u tekstu koji slijedi. Uz potrebna pojašnjenja. Knjiga se u osnvi sastoji od tri dijela. rabe se kratice naziva nukleinskih kiselina. Drugi dio sadrži više stotina pitanja s proteklih razredbenih ispita s uputama za njihovo rješenje.PREDGOVOR Onome tko se želi brzo i kvalitetno pripremiti za polaganje razredbenog ispita iz biologije. Tako se brzo ovladava gradivom i stječe sigurnost neophodna za uspješan izlazak na razredbene ispite. Dakle. Upute se prije svega odnose na savjet koji pojam odnosno koje objašnjenje treba pročitati da bi se razjasnilo rješenje zadatka kojega se rješava. aminokiselina. To se postiže tako da se tumačenje ključnog pojma iz pretpostavljenog odgovora također potraži u Leksikonu. prema engleskom nazivu. To su. nukleotida. ova se knjiga odlikuje jednostavnim razjašnjenjima zašto je neki odgovor u danom zadatku točan. na bilo kojem od fakulteta na kojem se polaže biologija. Naime. Kratica isp. Ova knjiga ne predstavlja samo pomoć za brzo i dobro pripremanje razredbenih ispita već i nešto više od toga.

ADAPTACIJA OKA. početni spoj Krebsova ciklusa. v. gonadotropne hormone. ABISAL. kiselica i borovica. To su različiti fizikalni i kemijski čimbenici okoliša koji utječu na život nekog organizma. v. antidiuretički hormon. hormon kojega izlučuje prednji N C H režanj hipofize (adenohipofiza). a bubrezi izlučivanjem vodikovih iona mokraćom. Sastoji se od acetilne skupine vezane na koenzim A (Co A). unaprijedio mikroskop povećavši njegovu moć razlučivanja. neurohormon kojeg parasimpatički živac-vagus luči na živčanim okončinama.5 - 5. ACIDOZA. rododendron. Ima bitno značenje u izmjeni tvari jer nije samo produkt razgradnje ugljikohidrata već i masnih kiselina te aminokiselina. v. E. ADH. u ATP-u. puferi. plućima i bubrezima. v. prilagodba oka na svjetlo ili tamu. Spoj sadržava tioestersku vezu bogatu energijom. Život u abisalu ovisi o gornjem osvjetljenom sloju u kojem se odvija primarna organska proizvodnja (bioproizvodnja) procesom fotosinteze. dubokomorski (oceanski) sloj. ADAPTACIJA.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE A ABBE. ADENOKORTIKOTROPNI HORMON (ACTH). ADENOZIN-TRIFOSFAT. organski spoj s dušikom iz skupine purinskih baza. jedna od skupina ekoloških čimbenika. ATP. NH2 N C H C N C C N H ADENOHIPOFIZA. makroevolucija. bjeloočnica. npr. pitomi kesten. ADENIN. v. On se oslobađa kada je smanjena potreba za kisikom (npr. ACIDO . zaštitna obojenost. ABIOTIČKI ČIMBENICI. voda odnosno vlaga. ACETILKOLIN. 9 . njemački znanstvenik i izumitelj koji je u 19. prednji režanj žlijezde hipofize koji izlučuje hormon rasta.BAZNA RAVNOTEŽA. prilagodba. ADAPTIVNA OBOJENOST.st. Sadržan je u najvažnijem pohranjivaču i prijenosniku energije u živoj stanici.4. ACIDOFILNE (kremene) BILJKE. svjetlost itd. Normalna koncentracija vodikovih iona (pH) arterijske krvi je oko 7. biljke koje rastu na kiselim tlima (pH 4. To su npr. v. ravnoteža kiselina i lužina u tijelu. ACETIL-CoA. kada spavamo) smanjujući udarni volumen srca.4). stanje sniženih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7. upozoravajuća obojenost i mimikrija. regulira se puferskim svojstvima tjelesnih tekućina.5). Pluća sudjeluju u održavanju te ravnoteže izdisanjem ugljikovog dioksida. ADAPTIVNA RADIJACIJA. v. Sudjeluje i u izgradnji nukleotida odnosno nukleinskih kiselina. Stimulira koru nadbubrežne žlijezde na izlučivanje kortikosteroidnih hormona kortizona i aldosterona. temperatura. v.bazna ravnoteža. adenokortikotropni hormon i tireotropni hormon. izvan granice prodora svjetla i pod visokim tlakom. acido .

ADP (adenozin-difosfat). strahu. Za AIDS je to smanjenje broja leukocita u krvi. HIV se najčešće prenosi spolnim kontaktom i krvlju (transfuzijom. zatim sa zaražene majke kroz posteljicu na nerođeno dijete. v. nositelje stanične imunosti. humani virus nedostatka imuniteta). AKTIVAN PRIJENOS (aktivan transport). odnosi se na organizme. osnovno staničja. privlačna sila između molekula različitih tvari koje se dotiču. Povezanost molekula vode s drugim molekulama (npr. injekcijskim iglama). povećani broj limfocita u cirkulaciji itd. krvne skupine. stezanje perifernih krvnih žila. AKSON (neurit). te ženinim mlijekom na dojenče (sisanje). Sadrži hidrolitičke enzime i omogućuje prodiranje spermija u jajnu stanicu prilikom oplodnje. prijenos tvari kroz staničnu membranu iz područja manje koncentracije u područje veće koncentracije neke tvari. smanjen broj zrelih T limfocita. smanjen broj limfocita u limfatičnim organima (limfnim čvorovima i slezeni). v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ADHEZIJA. Tako adrenalin uzrokuje pojačani intenzitet rada srca. pojedini zglobovi i dr. Virus je nazvan HIV-om (Human Immunodeficiency Virus. AERENHIM. v. bolu. šoku. širenje očnih zjenica. AKROSOM. AKOMODACIJA OKA. AGLUTININ. AIDS (SIDA). v. disanje. vršno tjelešce koje se nalazi na vršnom dijelu glave spermija. ADRENALIN. Pojačano se izlučuje u različitim stresnim stanjima. AGLUTINACIJA. širenje bronhiola. AEROBNA RESPIRACIJA.limfocite. živčana stanica. uz stijenku kapilara kod biljaka) omogućuje uzlazni tok vode u biljci. označuje prisutnost kisika. v. v. jakom uzbuđenju itd. leća. Njegovo djelovanje je višestruko i svodi se na podizanje svih važnih funkcija u organizmu na višu razinu kako bi organizam što bolje prebrodio stres. pojava sljepljivanja krvnih stanica u slučaju primitka krvi neodgovarajuće krvne grupe. AGRANULOCITOZA. Uzročnik je virus (retrovirus) koji napada i uništava T4 . bjelančevinasta molekula koja izgrađuje miofibrile. električni potencijal. bolest smanjenog ili zaustavljenog stvaranja granulocita u koštanoj moždini. prilagođavanje oka na gledanje blizu i daleko. Javlja se u odraslo doba. nenormalan rast pojedinih dijelova tijela kao što su šaka. eritrociti ADVENTIVNO KORIJENJE. manja količina protutijela (Ig). AGLUTINOGEN. gljivične bolesti i tumori. v. v. v. okoliš ili na stanične procese koji zahtijevaju prisustvo kisika. AEROBAN. hormon kojega izlučuje srž nadbubrežne žlijezde. stezanje mnogih mišića. AKCIJSKI POTENCIJAL. npr. AKTIN. stopalo. Kao posljedica agranulocitoze često se javlja povećana sklonost bakterijskim i gljivičnim infekcijama. ADULTNI HEMOGLOBIN. AIDS je za sada neizlječiva bolest imunološkog sustava za vrijeme koje nastaju vidljive promjene: (oportunističke infekcije) upala pluća i moždane ovojnice. engleska odnosno francuska kratica za sindrom stečene imunodeficijencije. AKROMEGALIJA. Taj 10 . v. poprečnoprugasti mišić. pojačani intenzitet i brzinu disanja. zbog povećanog lučenja hormona rasta. ATP. v. krvne skupine. korijen.

ALERGIJA (alergijska reakcija). organizam nakon kontakta s određenim antigenom stvara specifične tvari imunološke reakcije (protutijela. ALGE. Prokrvljena je mnogim kapilarima te sudjeluje u disanju i hranjenju zametka. Njihove hife nemaju poprečnih stijenki pa sliče dugim razgranatim cijevima s puno jezgara. jedan od hormona kore nadbubrežne žlijezde. za drugo B i b. neki lijekovi. zelene. Taj hormon održava stalnu razinu iona natrija. jedan od stupnjeva onečišćenja voda. kemijski spoj iz skupine aminokiselina. Ako dominantnost nije izražena aleli se mogu označavati s a1 i a2. prašina. majmuna. ALERGENI . aktivni prijenos. maline. ALBINIZAM. Aktivna imunost može biti stečena prirodnim putom (ljudi koji su preboljeli neku zaraznu bolest imaju gotova specifična protutijela s kojima mogu uništiti isti antigen u slučaju ponovnog unosa u tijelo) ili umjetnim putom (cijepljenjem). na primjer u miševa. ALFA-AMILAZA. Od tih skupina samo 11 . autotrofne fotosintetske steljnjače među kojima postoje velike razlike. itd. plazmi). (alelni geni. AKTIVNO STEČENA SPECIFIČNA IMUNOST. smeđe i crvene alge. ALANIN. klora i kalija u tijelu. ALBUMIN. ALGAŠICE. poput alga. U jednom organizmu za neko fenotipsko svojstvo mogu biti najviše dva različita alela. npr. itd. Najvažniji podražaj za lučenje hormona je niska koncentracija iona natrija u izvanstaničnoj tekućini (npr. AKTIVNI TRANSPORT. kunića. ALANTOIS. a recesivni malim slovima. gljive koje. Klasični primjer aktivnog prijenosa je transport iona natrija (Na+) iz stanice u međustanični prostor i iona kalija (K+) iz međustaničnog prostora u stanicu. Tvari koje uzrokuju alergije zovu se alergeni.). različita kemijska sredstva (detergenti. v. Aleli pojedinih svojstava označuju se obično slovima abecede i to dominantni velikim. ALFA-MEZOSAPROBNE VODE. kremenjašice. nedostatak pigmenta u koži i/ili drugim organima. neke vrste hrane (jagode. a određuje ga recesivni gen koji se nalazi na autosomima (nespolni kromosomi). homologni geni) su par gena koji određuju isto svojstvo. alergija.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE prijenos se može odvijati samo uz pomoć membranskih “prenositelja” i uz utrošak energije iz ATP-a. v. Ovaj oblik aktivnog prijenosa susreće se u membranama gotovo svih animalnih stanica. v. žive u vodi kao saprofiti ili paraziti. a najčešći su pelud. Stanična stijenka im je od hitina. za jedno svojstvo A i a. kod amniota. druga zametna ovojnica koja obavija zametak. ALDOSTERON. sir). Sintetizira se u jetri odakle se otpušta u krv. v. tzv.). kozmetički preparati) itd. a to pojačava upijanje iona natrija u kapilare uz nefrone. b1 i b2. bjelančevina u krvi (oko 34 do 50 g/L) koja sudjeluje u prijenosu različitih hormona. Aldosteron koji je oslobođen u krvi. ALELNI GENI. ali i nekih životinja. ptijalin. filtrira se u nefron. natrijeva i kalijeva pumpa. Skupine algi su bičaši. ALELI. a predstavlja snažno onečišćene vode. a samo kod najprimitivnijih od celuloze. a nalaze se na paru homolognih kromosoma (isp. Nasljedno svojstvo koje se pojavljuje u čovjeka. limfocite T i dr. specifičan oblik imunološke reakcije odnosno preosjetljivost (hipersenzitivnost) na neke tvari. aleli.

a radi mriještenja zalaze u slatke vode. specijacija kada su populacije odvojene zemljopisnom barijerom. v. organski spojevi koji izgrađuju bjelančevine. acido .lizin.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ crvene alge nemaju pokretne stanice s bičevima niti u jednom razvojnom stadiju. skupine životinja (gmazovi. specijacija. Razlozi su najčešće u poremećaju ravnoteže spolnih hormona i gonadotropnih hormona. To je vrećasta tvorba ispunjena bjelančevinastom tekućinom u kojoj pliva zametak. vodožilni sustav. Razvoj u novu vrstu zbiva se u prostorno izoliranim populacijama koje potječu od zajedničkog ishodišta. izoleucin. U molekuli fosfolipida električki nabijen kraj privlači molekule vode (hidrofilan). selidba riba. glutaminska kiselina. Amfipatske molekule su npr. označuje odsutnost zraka. Svaka aminokiselina sadrži dvije karakteristične kemijske skupine: karboksilnu (COOH) i amino (NH2) skupinu. Isp. alanin. lososi. AMEBNA DIZENTERIJA. v. triptofan. molekule koje na jednom svome kraju privlače vodu. ATP. serin. nasljedni nedostatak enzima zbog čega se nakuplja homogenetizirana kiselina u mokraći. v. okoliš ili na stanične procese za koje nije potrebna ili je čak štetna prisutnost kisika. AMBULAKRALNI SUSTAV. metionin. v. tirozin. leucin. v. glutamin. ALOPATRIJSKA SPECIJACIJA. cistein. npr. AMNIOTA. v. izostanak mjesečnice. v. H H H O N C C OH R AMNION. odnosno kisika. a koja na zraku potamni. aspargin. treonin. AMINOKISELINE. ali samo 20 dolazi u živim organizmima. sintetički procesi u kojima se od malih građevnih elemenata izgrađuju ili polimeriziraju veće molekule. v. ALKOHOLNO VRENJE. govori se o primarnoj amenoreji.4). ALVEOLE. asparginska kiselina. a međusobno se aminokiseline razlikuju po vrsti radikala. AMP (adenozin-monofosfat). kod amniota. Poznato je oko 70 različitih aminokiselina. AMERIA. dodatak 5. v. Ako se ne pojave prve mjesečnice u pubertetu. ALKAPTONURIJA. histidin. leukoplasti. prva unutarnja zametna ovojnica koja obavija i zaštićuje zametak od trešnje i pritiska. valin. plućni mjehurići. a na drugom odbijaju vodu. ANADROMNE SELICE. AMFIPATSKE MOLEKULE. Amniota nemaju stadij ličinke i njihov razvitak teče bez preobrazbe. ptice i sisavci) kod kojih se pojavljuju tri zaštitne zametne ovojnice: amnion. ribe koje žive u moru. kvaščeve gljivice.bazna ravnoteža. prolin i arginin. AMILOPLAST. a električki nenabijen kraj s masnim kiselinama odbija vodu (hidrofoban). v. ali žive u raznim sredinama. ANAEROBAN. beskolutićavci.To su: glicin. Pojavili su se u karbonu. ALKALOZA. ANABOLIZAM. dizenterija AMENOREJA. odnosi se na organizme. a ako izostanu mjesečnice kod žena koje su ih imale redovito govori se o sekundarnoj amenoreji. 12 . molekule fosfolipida. stanje povišenih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7. fenilalanin. alantois i seroza.

uzbuđenje. v. Javljaju se abnormalnosti u razvitku.hemolitička anemija. ANDROGENI (muški spolni hormoni). Zbivanja u anafazi II su ista kao i u anafazi mitoze gdje se svaki dvostruki kromosom dijeli na dva jednostruka koji putuju na suprotne polove stanica. kao npr. Stanice imunološkog sustava ispuštaju histamin. Može doći do gušenja i smrti pri unašanju veće količine specifičnog alergena (npr.). srpastu anemiju. ANATOMIJA. v. Na početku anafaze svaki kromosom razdvoji se na dvije kromatide koje zatim putuju prema suprotnim polovima stanice vučene teznim nitima diobenog vretena. Za razliku od profaze i metafaze u kojima su kromosomi dvostruki. spolno nerazvijena i nespolna (ima nerazvijene jajnike) ili Klinefelterow sindrom (47. slabost. anafaza I. Povećane fizičke aktivnosti. anafaza I. v. v. je promjena u broju samo jednog ili nekoliko kromosoma.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE ANAEROBNA RESPIRACIJA. Simptomi su: bljedoća. stadij mejoze (isp. 48 xxxy) kod muškaraca izaziva ženske osobine (mliječne žlijezde) i sterilni su. ANAFAZA. ANGINA PEKTORIS (stenokardija). anafaza mejoze II). Takvi su organi prilagodba na slične uvjete života. ANALOGNI ORGANI. Turnerov sindrom 45xo. koje uglavnom nisu letalne. Npr. hormoni koji se stvaraju u sjemenicima i kori nadbubrežne žlijezde. bolesti pri kojima su tkiva preslabo opskrbljena kisikom zbog smanjene količine hemoglobina i broja eritrocita u krvotoku. umor. znanost koja proučava makroskopsku građu tijela svih živih bića. nego se tako nazivaju boli koje nastaju kad srčani mišić ostane privremeno bez kisika. U anafazi I razdvajaju se homologni kromosomi i putuju prema suprotnim polovima stanice stezanjem teznih niti diobenog vretena. Najčešće zahvaća spolne kromosome. penicilina). nesvjestica. nije bolest. stadij mitoze (isp. ANAFILAKTIČKI ŠOK. anafazni kromosomi su jednostruki odnosno sastoje se od jedne kromatide. svaki je građen od dvije kromatide. anafaza II. ANAFAZA DRUGE MEJOTIČKE DIOBE. teško alergijsko stanje u kojem drastično padne minutni volumen srca i arterijski tlak. velike i nagle temperaturne razlike povećavaju aktivnost srca (broj ot- 13 . Neke anemije uzrokuju genetski čimbenici. a funkcija im može biti slična. ANAFAZA II (anafaza druge mejotičke diobe. Ostale mogu biti posljedicom ubrzanog raspada eritrocita ili hemolize . gubitak daha i lupanje srca. ANEMIJE. ženska osoba s jednim x-kromosomom. nedostatka željeza u hrani – sideropenična anemija ili manjka vitamina B perniciozna anemija. v. odnosno.). krilo ptice i krilo kukca.). Anafaza završava kada kromosomi stignu na suprotne polove stanice. xxy. anafaza II. anafaza mejoze I). ANAFAZA MEJOZE II. ANAFAZA I. ANAFAZA MEJOZE I. npr. stadij mejoze (isp. Kromosomi u anafazi I su dvostruki. Sjemenici stvaraju i luče nekoliko spolnih hormona od kojih je najvažniji testosteron. disanje. Spolni hormoni koje luči kora nadbubrežne žlijezde zovu se adrenalni androgeni od kojih je najvažniji dehidroepiandrosteron. a u manjoj mjeri i u jajnicima. ANEUPLOIDIJA. organi u raznih skupina organizama koji su različitog pod- rijetla. ANAFAZA PRVE MEJOTIČKE DIOBE. (anafaza prve mejotičke diobe.

svaka tvar koja može izazvati imunološku reakciju organizma. izlazi iz lijeve klijetke srca. ANTERA. najveća arterija. ANTIGEN (imunogen). veliki optok. v. hormon koji luči stražnji režanj hipofize (neurohipofize) ako u organizmu nedostaje vode. ANTITIJELA. zelene alge. v. ADH se transportira krvlju u čahuru nefrona gdje djeluje na stanice stijenki kanalića nefrona da postanu propusnije za vodu. rakovi. a zatim se spoji s kodonom (šifrom) na mRNA. kemijska tvar koja spriječava razvitak određenih vrsta bakterija. razvitak sjemena bez oplodnje (nespolno razmnožavanje). ANTIDIURETIČKI HORMON (ADH). ANTITETSKA IZMJENA GENERACIJA. obrambene bjelančevine koje stvara organizam kada u njega uđu antigeni. a to središte šalje impulse živčanim putem u stražnji režanj hipofize koja počne lučiti ADH. ako je krvna plazma hipotonična (popili smo previše vode) prestaje se lučiti ADH te se u nefronima voda neće reapsorbirati u krv. v. APOMIKSIJA. Apomiksiju nalazimo npr. APIKALNI MERISTEMI. u najširem smislu. evoluciju. Ako krvna plazma postane hipertonična. Dakle. v. neke alge). U tom se slučaju jajna stanica samo diploidizira (udvostruči se broj kromosoma) bez oplodnje. APOSEMIJA. Mogu ih proizvoditi čak i neke vrste bakterija. Većina antitijela stvara se u plazma stanicama i B limfocitima. ANTROPOLOGIJA. v. APIKALNA DOMINACIJA. u maslačka. isp. posebice ljudske rase. v. povećava se respiracija vode iz filtra natrag u krv. ANTERIDIJI. npr. sredstva koje snizuju povišenu tjelesnu temperaturu. pojava u kojoj vršni pup djelomično ili potpuno inhibira rast bočnih pupova. ANTIPIRETICI (antipirogene tvari). 14 . Anteridija nema kod najprimitivnijih (bakterije. mikrobiološka metoda kojom se ispituje djelovanje niza različitih antibiotika na izoliranu bakteriju uzročnika bolesti. vršni meristemi APLASTIČNA ANEMIJA. ANTIBIOGRAM. sjeme i zatim biljka koja je potpuno jednaka kao i roditeljska biljka. upozoravajuća obojenost. ANTIKODON (protušifra).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ kucaja) i potrebu za kisikom iznad mogućnosti koronarnog optoka. ANTIBIOTIK. ANTENALNE ŽLIJEZDE. upala crvuljka. nego će se lučiti iz tijela mokraćom. ticalne žlijezde. AORTA. ponašanje i dr. Od nje se razvije zametak. znanost koja proučava čovjeka. bolest smanjene proizvodnje eritrocita u koštanoj moždini. Naprotiv. APENDICITIS. prašnik. skupina triju baza na molekuli transportne RNA (tRNA) koje su komplementarne bazama na molekuli glasničke RNA (mRNA). bakterije roda Streptomyces proizvode streptomicin. i najsavršenijih (kritosjemenjače) biljnih skupina. Ovom metodom utvrđuje se najdjelotvorniji antibiotik za liječenje određene bakterijske bolesti. Antikodon raspoznaje. podražuje središte za žeđ u mozgu. Kao posljedica javlja se jaka bol u prsima. koja uglavnom prestaje sa smanjenjem aktivnosti tijela. muški rasplodni organi biljaka u kojima nastaju muške spolne stanice.

potiče dormanciju i pomaže biljci da preživi u stresnim uvjetima (regulirajući vodnu ravnotežu). Nastaje u jednoj od etapa embrionalnog razvoja složenih životinjskih organizama. endemične vrste imaju vrlo mali areal. v. v. preteča je crijeva. tise. ASKOSPORE. v. ARTERIOSKLEROZA. ARHENTERON (pracrijevo). kemijski spoj iz skupine aminokiselina. ovapnjenje krvnih žila). ASKUSI. prostor na kojem je raspoređena neka vrsta organizama ili opseg prostorne rasprostranjenosti neke vrste. Starenjem arterije su sklone degenerativnim promjenama i otvrdnuću odnosno gubitku elastičnosti pa se zbog toga teže prilagođavaju održavanju stalnog krvnog tlaka. a podraživanjem parasimpatikusa arterije se šire (vazodilatacija). ali i žile odvodnice. APSORPCIJA HRANE. ženski rasplodni organi biljaka u kojima nastaju ženske spolne stanice. na tom mjestu se stvara tromb koji se može otrgnuti (embol) i kolati krvlju 15 . jer odvode krv iz klijetki srca. dozrijevanje plodova. v. biljni hormon koji inhibira rast. Kontrolira završne razvojne stadije biljaka: starenje. ARILUS. Apsorpcija hrane se najvećim dijelom obavlja u tankom crijevu pomoću epitelnih stanica crijevnih resica. kemijski spoj iz skupine aminokiselina. ostatak repa i dr. v. Smještene su u dubini organizma. papratnjača i donekle u promijenjenom obliku u golosjemenjača. prostor koji nastaje uvrtanjem (invaginacijom) endoderma u šupljinu gastrule. elastično tkivo i unutarnja stijenka (endotel). v. bolest arterijskih krvnih žila. Areali se razlikuju po obliku i veličini. mješinarke. mješinarke. Zbog oslobođenog histamina stežu se mišići dišnih putova i disanje je otežano. praptica. ASPARGINSKA KISELINA. ARCHAEOPTERYX. veći broj mliječnih žlijezda. ASIMILACIJA CO2. a bila su svojstvena davnim precima. Povezane su s ograncima autonomnog živčanog sustava. ateroskleroza. ARHEGONIJ. venuće cvjetova. Glavni uzrok smanjenja elastičnosti jest taloženja masnoća u obliku jastučića (aterom) na unutarnjim stijenkama arterija zbog čega se smanjuje njihov promjer. otpadanje listova. fotosinteza. v. ASTMA. pojava nekih obilježja koja se rijetko javljaju i to samo kod određenih jedinki neke vrste. ateroskleroza. ATAVIZAM. Ako jastučić pukne. megaevolucija. ASPARGIN. ARGININ. AREAL. a time i protok krvi. žile kucavice. Stijenke arterija građene su od vanjskog elastičnog omotača ispod kojeg se nalazi mišićni sloj. ATEROM. kemijski spoj iz skupine aminokiselina. AROMORFOZA. ATEROSKLEROZA (arterioskleroza. Sintetizira se u stanicama koje sadržavaju kloroplaste ili amiloplaste. ARTERIJE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE APSCIZINSKA KISELINA. npr. Podraživanjem simpatikusa nastaje stezanje (vazokonstrikcija). upijanje hrane u probavnom sustavu iz probavila u krvotok i limfotok. Primjeri atavizma u čovjeka su prekomjerna dlakavost cijelog tijela. Atavizmi su važan dokaz evolucijskih procesa. čest oblik alergijske reakcije. Nalazimo ga u mahovina. a djelomice u debelom crijevu gdje se uz konačnu apsorpciju hrane upijaju voda i minerali. v.

Ova metoda ima važnu ulogu u proučavanju kemijske građe stanice i staničnog metabolizma. bubrega i srca. čovjekov predak s djelomice ljudskim osobinama. AUTORADIOGRAFIJA. Dijelimo ga na simpatikus i parasimpatikus. priključivanju energijom bogatih veza između fosfatnih skupina u nukleotidima. npr. samonikao. dio živčanog sustava koji nije podložan djelovanju naše volje. ATP → ADP + P + energija ADP → AMP + P + energija Odvajanjem druge fosfatne skupine opet se oslobađa energija i nastaje spoj adenozin-monofosfat (AMP). AMP nema niti jednu vezu bogatu energijom. pluća. proizvodnja topline. v. tromboza. ATP (adenozin-trifosfat). Posebno su ugrožene krvne žile mozga. v. je spoj iz skupine nukleotida koji se sastoji od adenozina (purinska baza adenin + šećer riboza) na koji su vezane tri fosfatne skupine. krvnih žila itd.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ sve dok ne začepi neku užu krvnu žilu. v. kretanje i sl. Kada je stanici potrebna energija ona se iz ATP-a oslobađa odjeljivanjem treće fosfatne skupine. Aterosklerotične promjene češće su u ljudi koji jedu masniju hranu. Prirodni se auksin većinom sintetizira u vršnim meristemima i mladim listovima u razvitku odakle se prenosi u ostale dijelove biljke. Nadzire rad većine unutarnjih organa. Nađeni su u južnoj i sjevernoj Africi. a sastoji se u tome da se u stanicu unose nestabilni. skupina biljnih hormona koji stimuliraju produžni rast stanica. npr. metoda koja se koristi u znanstvenim istraživanjima. katalizator mijene tvari koji sudjeluje u oslobađanju odnosno. (vegetativni živčani sustav). NH2 N OH HO O OH O OH O N N N birana molekulama klorofila u procesu fotosinteze. AUKSINI. Za sintezu ATP-a koristi se energija oslobođena u procesu staničnog disanja u mitohondrijima i svjetlosna energija apsor- 16 . sekundarni rast i razvoj plodova. AUTOPURIFIKACIJA VODA. dodatak 5. probavnih organa. To su najstariji nalazi pravih hominida humane faze. samoočišćenje voda. Proces sinteze ATP-a iz AMP-a i ADP-a naziva se fosforilacija: AMP + P + energija → ADP ADP + P + energija → ATP. te se posebnim postupcima prati njihov položaj i raspored u stanici. ATPaza. Ta se energija može osloboditi i koristiti za različite aktivnosti stanica. Najstariji nalazi australopitekusa stari su oko četiri milijuna godina. AUSTRALOPITEKUS (Australopithecus. AUTOHTON. radioaktivni izotopi. koji od davnina živi u nekom kraju. srca. južni pračovjek). AUTONOMNI ŽIVČANI SUSTAV. pušača cigareta i predebelih osoba. P O P O P OCH2 O H H H H OH OH AMP ADP ATP Kemijske veze među fosfatnim skupinama sadrže veliku količinu energije. sintetske aktivnosti. Pri tome nastaje energetski siromašniji spoj adenozin-difosfat (ADP).

kao i svaka prokariotska stanica. čija se DNK podijeli uzdužno.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE AUTOSOMI. v. nastanu dvije nove stanice 17 . Koki i bacili često stvaraju manje ili veće nakupine (diplokoki. Protoplazma bakterijske stanice obavijena je polupropusnom membranom lipoproteinske strukture. BACILI. Osnovu protoplazme čini citoplazma u čijem je središtu nukleoid koji po funkciji odgovara jezgri eukariotske stanice jer čini genetički materijal bakterijske stanice. jednostanični prokariotski organizmi (najjednostavnije građeni stani- čni organizmi) čija je prosječna veličina 1 μm. Nalaze se na prvom mjestu hranidbenih lanaca u kojima nakon njih dolaze mnogobrojne serije potrošača (konzumenata). O. utvrđuje i pojašnjava rezultate Griffithovog pokusa dokazavši da je DNA tvar koja uzrokuje pretvorbu (transformaciju) pneumokoka. AVERY. AUTOTOMIJA. kemosintetske) i heterotrofi (saprofiti. stafilokoki i sl. a ako potrebnu energiju za stvaranje dobivaju od kemijskih reakcija (kemosinteza) onda su kemoautotrofi.T.) dok vibrioni i spirili dolaze pojedinačno. Neke bakterije imaju i vanjsku ovojnicu polisaharidne građe koja izvana oblaže staničnu stijenku i zove se kapsula. autotrofi. zajedno sa suradnicima 1944. v. diobom ili cijepanjem pri čemu od jedne bakterijske stanice. Fotosintetske membrane po funkciji odgovaraju kloroplastima eukariotske stanice. ali su nosioci gena za druga svojstva. Nukleoid je građen od molekule DNA koja je zatvorena u prsten i gusto sklupčana. Tipična bakterijska stanica. AUTOTROFNI PROIZVOĐAČI. razdoblje nakon porođaja koje traje oko 4 do 5 tjedana. AUTOTROFI (autotrofni organizmi). v. mitohondrije i kloroplaste. AUTOTROFNI PRODUCENTI. bakterije. nabore stanične membrane koji su po svojoj funkciji slični mitohondrijima. BAKTERIJE. a kod fotosintetskih bakterija i posebne membrane na kojima se odvija fotosinteza. Najčešće se razmnožavaju vegetativno. paraziti). samosakaćenje. U citoplazmi se nalaze i ribosomi te pričuvne hranjive tvari (masne kapljice. autotrofi. autotrofi. v. kromosomi koji ne određuju spol. Općenito se dijele na aerobne i anaerobne. Njihovim fotosintetskim procesima nikada se ne oslobađa kisik. god. Izvana je obavijena debelom staničnom stijenkom koja sadrži organsku tvar murein. oblika zareza (vibrioni) i spiralno savijene (spirili). organizmi koji su sami sposobni stvarati vlastite organske spojeve. polisaharidi). AUTOTROFNI ORGANIZMI. Ako se za stvaranje takvih organskih spojeva koristi sunčeva svjetlost (fotosinteza) onda su to fotoautotrofi. Autotrofni proizvođači (producenti) čine temelj ishrane svake životne zajednice (biocenoze). To je vrijeme koje je potrebno da se maternica smanji i vrati u normalno stanje. B BABINJE (puerperium). štapičaste (bacili). streptokoki. Bakterijske stanice mogu biti različitog oblika. Prema načinu ishrane bakterije mogu biti autotrofi (fotosintetske. nema oblikovanu jezgru ni druge složene stanične organele. npr. v. Bakterijska stanica sadrži i mezosome. a obično razlikujemo četiri glavna: kuglaste (koki).

životne zajednice vezane za dno jezera ili mora. Važnu ulogu u bazalnom metabolizmu imaju hormoni štitnjače (tiroksin i trijodtironin). repa. skupina suvremenih lijekova koji snizuju krvni tlak smanjenjem snage kontrakcije srca. mozga itd. Prema zoologu Hadžiju razvili su se iz trepetljikavih mnogojezgrenih jednostaničnih oblika. posebna skupina virusa koja napada bakterije. soja i špinat. biljke koje rastu na tlima s relativno visokom pH vrijednošću (pH 6.vagilni organizmi (rakovi. BAKTERIOFAGI (bakterijski virusi. a bakterijska stanica se raspada te iz nje izlaze novonastali fagi. mekušci. BAKTERIOLOGIJA. kupus. stapčarke. Nakon 20 do 30 minuta proces razmnožavanja faga je završen. v. Uglavnom su bilateralno simetrične i pokretne životinje. stapčarke. biološka znanost koja se bavi proučavanjem bakterija. BETA-MEZOSAPROBNE VODE. nekolutićavog tijela.5). BEZGREBENKE. fagi). Najpoznatiji su skokuni i četinaši. cvjetača. BETA-BLOKATORI. BENTOSKA BIOCENOZA. tj. jedan od stupnjeva onečišćenja voda. BAZIDIJ. BAZALNI METABOLIZAM. bakteriofagi. U okviru bentoskih biocenoza neke se životinje pokreću vlastitom snagom . krvotoka. BEZLATIČNICE. oblenjaci. BENTOS. v. bubrega. Na glavicu se nastavlja kontraktilni rep čiji je središnji dio poput šupljeg štapića izvana obavijenog stezljivim ovojem. U obliku spora bakterije mogu preživjeti i tisuću godina te nakon toga u povoljnim uvjetima opet “proklijati” u aktivni oblik. leukociti. BAZOFILNE (vapnenačke) BILJKE. BAZOFILNI LEUKOCITI. osnovni promet tvari i energije u organizmu koju tijelo troši za održavanje temeljnih životnih funkcija. To su npr. Uz pomoć pipaka fag se prihvati na staničnu stijenku bakterije i stezanjem repa ubaci nukleinsku kiselinu u njenu unutarnjost. ribe. staročeljuske. v. v. Tipični bakteriofag građen je od glavice u kojoj se nalazi DNA ili RNA obavijena proteinskim ovojem. šira skupina dvosupnica koja obuhvaća porodice drvenastih biljaka značajnih u izgradnji šumske listo- 18 . Hemisesilni organizmi se mogu kretati. Danas živi oko 170000 različitih vrsta. za rad srca. v. BATALJICA. parapodij.. a predstavlja umjereno onečišćene vode. Povećana razina tih hormona u krvi povećava bazalni metabolizam. Prema građi tijela dijele se u skupine: plošnjaci. BAZIDIOSPORE. BEZKRILCI. v. skupina kukaca koja ni u jednom stadiju života nemaju krila niti su ih imali tijekom evolucije. Na dnu repa nalazi se pločica sa pipcima.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ genetički posve jednake početnoj stanici. BAKTERIJSKI VIRUSI. hormon prednjeg režnja hipofize (hormon rasta) i spolni hormoni. ali uglavnom ostaju na istom mjestu (hobotnica). Sjedilački ili sesilni organizmi su pričvršćeni za podlogu (alge jadranski bračić i jadranski klobučić). životna zajednica raznovrsnih organizama koji žive na morskom dnu. žarnjaci. osim žarnjaka. Neke bakterije imaju sposobnost da u nepovoljnim uvjetima iz aktivnog oblika prijeđu u trajne oblike ili spore koje su obavijene čvrstom ovojnicom. ježinci). beskralježnjaci jednostavnog. luk.7. dišnog sustava.5 . Pod kontrolom nukleinskih kiselina bakteriofaga stvaraju se u bakterijskoj stanici novi fagi. BESKOLUTIĆAVCI (Ameria).

BEZREPCI. BILJKE DUGOG DANA (kratke noći). BIJELO TIJELO (corpus albicans). krastače i zelene žabe. kritično razdoblje tame. više biljke. BEZLUBANJCI. Kao prvi stanični organizmi s jezgrom. Žive u tropima. (biljna tkiva). životinjama i gljivama pa se pretpostavlja da imaju važnu ulogu i u njihovoj evoluciji. cer. Bičaš tripanosoma je uzročnik spavanja u tropskim krajevima. a njegovo mjesto ispunja vezivno tkivo te ostavlja ožiljak. v. v. biljke koje cvjetaju krajem ljeta. v. BILJNA STANICA (fitocelula). BILJNA STANIČJA. najčešće kukcima. Glavni predstavnici su žabe. BILIRUBIN. žive slobodno u vodama ili zadružno. Bičaši imaju posebno značajnu ulogu primarnih proizvođača hrane. Razmnožavaju se najčešće nespolno. U idućih nekoliko tjedana propada i bijelo tijelo. Druga velika skupina su životinjski bičaši. Bezlatičnicama pripadaju i porodica breze i lijeske s predstavnicima johe i graba. Bijelo tijelo nastaje propadanjem žutog tijela. lužnjak. BILJKE KRATKOG DANA (duge noći). BIG BANG. Mnogi žive kao plankton slatkovodnih stajačica i u toplim morima. krizantema). Bičaši koji pripadaju skupini biljnih bičaša su autotrofni jer u protoplazmi imaju kloroplaste. Prilagođeni su oprašivanju vjetrom. razvila su se u skladu s preuzimanjem najraz- 19 . Dijele se na steljnjače.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE padne vegetacije. v. a razdoblje tame je dulje od kritičnog (npr. višestanična tvorevina koja nastaje u jajniku 10 do 14 dana nakon ovulacije u slučaju kada nije došlo do oplodnje jajne stanice. Imaju neugledne cvjetove bez latica. Te biljke trebaju dan duži od 12 sati. Tijelo im pokriva pelikula. ili početkom ljeta kada su dani dugi. svitkovci. stanica. dvobočna simetrija. dub. BIJELE KRVNE STANICE. skupina vodozemaca čije je obilježje da odrasli oblici nemaju repa. gdje gmižu kroz vlažno tlo. v. v. eritrociti. v. halofiti. Žive na kopnu i u slatkoj vodi. puls. a razdoblje tame je kraće od kritičnog (npr. Posebno je uočljiv organel očna pjega ili stigma. Poznata porodica su rijači. imaju neke osobine slične biljakama. v. Preobrazba teče preko ličinke (v. leukociti i krvna tjelešca. Stražnji par nogu duži je od prednjih. praživotinje. pitomi kesten i različite vrste hrastova: kitnjak. U porodicu bukve pripadaju bukva. BILO. a mnogi su i nametnici na čovjeku i životinjama. Tipičan predstavnik je euglena (Euglena viridis). medunac i vazdazeleni hrast crnika ili česmina. Poznatije su žabe u našim krajevima: mukači. Te biljke trebaju dan kraći od 12 sati. biljke koje cvjetaju krajem proljeća. skupljene u rese. Heterotrofni su organizmi. BEZNOŠCI. v. BILJKE. prilagođen za skakanje. BILATERALNA SIMETRIJA. v. u jesen ili zimi kada su dani kratki. punoglavac). BIČAŠI. niže biljke i stablašice. skupina vodozemaca bez nogu. BILJKE SLANIH STANIŠTA. uzdužnom diobom.mnoge trave i žitarice). Spolno razmnožavanje je rijetko. a trihomonas je čest nametnik u spolnom sustavu čovjeka. Isp. gatalinke. veliki prasak. kritično razdoblje tame. Na nogama imaju razvijene plivaće kožice. imaju najčešće 1 ili 2 biča koji im služe za pokretanje u vodi. autotrofni fotosintetski eukarioti. Hrane se sitnim životinjama. stanica.

kisika i dušika. poznati švedski prirodoslovac Carl Linné. a drugo ime vrste. a alba vrstu (bijeli). BIOCID. v. biljna staničja. anatomija. citologija. znanost o evoluciji. sistematika ili taksonomija i dr. biološka raznolikost. Prvo ime uvijek označava ime roda. fitofagi. BIOGEOGRAFIJA. fiziologija. tijek kruženja različitih kemijskih elemenata u biosferi. v. BIOLOGIJA. BIOLOŠKA OKSIDACIJA. BILJNO BOJILO (pigment).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ličitijih uloga u prilagodbi kopnenom načinu života. paleontologija. BILJNI HORMONI (regulatori rasta). giberelini) i dvije vrste koji inhibiraju rast (apscizinska kiselina. herbivori. BIODIVERZITET. v. se odnosi na raznolikost svih živih bića. murva). Različiti pigmenti apsorbiraju različite valne duljine svjetlosti. a mogu se uglavnom svesti na sljedeće oblike: tvorna staničja. etilen). znanost o biocenozama. BILJOJEDI. embriologija. v. Učinci pojedinih biljnih hormona nisu specifični (za razliku od animalnih hormona). kemijska tvar koja se u ratarstvu i šumarstvu primjenjuje za uništenje populacije različitih “štetnika”. isp. BIOGEOKEMIJSKI CIKLUSI. zoologija. BILJNA TKIVA. BIOGENI ELEMENTI. citokinini. Najvažniji su: zeleni klorofili (klorofil a i klorofil b). spojevi koji utječu na rast i diferencijaciju tkiva i organa. Sintetiziraju se u vrlo malim količinama. npr. genetika. koja se pohranjuje u kemijskim vezama šećera i drugih organskih molekula koje nastaju u procesu fotosinteze. tvari koje apsorbiraju sunčevu svjetlosnu energiju i pretvaraju je u kemijsku energiju. BIOKATALIZATORI. životna zajednica. koja je značajna za održavanje biološke ravnoteže svih živih sustava na Zemlji. vodika. rekreacijsku i estetsku vrijednost. Od svih pigmenata u biljnom tkivu jedino klorofil a može neposredno sudjelovati u pretvorbi sunčeve energije u kemijsku. BINOMNA NOMENKLATURA (dvojno nazivlje). biljnih i životinjskih organizama. Biološka raznolikost ima ekološku. insekticidi i fungicidi.evolucija. v. To su herbicidi. v. biljna geografija) i životinja (zoogeografija) na Zemlji i uzroke te rasprostranjenosti. BIOLOŠKA EVOLUCIJA. Binarnu nomenklaturu uveo je u upotrebu u 18. BIOCENOZA. virusi. Postoje tri skupine koji stimuliraju rast i druge procese (auksini. Predmet proučavanja biologije veoma je širok pa se ona dijeli na veliki broj užih biologijskih znanosti: botanika. karotenoidi (žuti i narančasti) i ksantofil (žuti pigment). st. kožna staničja. molekulska biologija. v.. ekologija. kulturnu. provodna staničja. v. Dodatak 3. tj znanost koja se bavi prou- čavanjem odnosa članova u biocenozi i odnosima biocenoze i uvjeta okoliša. znanost koja proučava živa bića. Tako. enzimi. v. Najvažniji biogeokemijski ciklusi su ciklusi ugljika. fitogeografija. žljezdana staničja i osnovno staničja. BIOCENOLOGIJA. BILJNI VIRUSI. obrazovnu. znanstvenu. društvenu. gospodarsku. znanost koja proučava rasprostranjenost biljaka (geobotanika. histologija. BIOLOŠKA RAZNOLIKOST (biodiverzitet). biljku bijeli dud ili bijela murva nazivamo Morus alba gdje Morus označuje rod (dud. disanje. znanstveno nazivlje za biljke i životinje koje se sastoji od dva latinska imena. potporna staničja. 20 .

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Međunarodni dan biološke raznolikosti je 29. BIOMASA.zjenicom (pupilla). endoderm i mezoderm. posebne skupine ekosustava koje se nalaze u većem pojasu kopna gdje su obilježja podneblja prilično izjednačena. a nalazimo ga isključivo u embrionalnom razvoju sisavaca (čovjeka). odnos predatora i plijena itd. biomase kod autotrofa i heterotrofa. otvor (uvrnuće) na površini gastrule vodozemaca koji vodi u šupljinu arhenterona ili pracrijeva. BJELANČEVINE. Vanjski sloj stanica zove se trofoblast. zatim tajge. proteini. oblik zametka nastao na kraju procesa brazdanja zigote. BIOTIČKI ČIMBENICI. BIOTOP. npr. v. To su uzajamni odnosi jedinki istih vrsta i jedinki različitih vrsta. zatim pojas listopadnih šuma itd. hidrosferu (sve vode na Zemlji) i prizemni sloj atmosfere . Te stanice izgrađuju površinski sloj blastule. prosinca. Čine je svi ekosustavi. U vodozemaca nastaje na početku jednog od stadija embrionalnog ravoja nazvanog gastrulacija i to na taj način da se stanice animalnog pola utiskuju između ekvatora i vegetativnog pola blastule. Blastocista ima oblik mjehurića sastavljenog od većeg broja stanica. simbioza. isp. tanak površinski dio Zemlje u kojem su prisutne zajednice svih živih bića i u kojem je moguć njihov opstanak. a unutarnja masa stanica embrioblast. BIOSFERA (grč. BLASTOPORUS. v. Biljke koje su poznati biološki indikatori onečišćenja su lišajevi i većina četinjača. Biomasa je mjerilo gustoće svake populacije. embrionalne stanice koje nastaju brazdanjem zigote. npr. a u kasnijem stadiju embrionalnog razvitka iz njega će se razviti zametni listići: ektoderm. najprije pojas tundre. 21 . Nastaje za vrijeme brazdanja zigote. jedna od skupina ekoloških čimbenika. i time povećava ili smanjuje prolaz zraka svjetlosti u oko. O količini pigmenta melanina u šarenici ovisi boja očiju. Njihov nestanak s određenog područja ukazuje na određen stupanj onečišćenja tog područja. v. BIOMI. BLASTOMERE. Postoji određena pravilnost u redoslijedu bioma od sjevernog pola pa do ekvatora. Na prednjoj strani je prozirna rožnica (cornea). sfaira = lopta). BLASTOCISTA. biljne i životinjske vrste koje su osobito osjetljive na različite oblike onečišćenja. Šarenica refleksno stezanjem ili opuštanjem pupilarnih mišića otvara ili zatvara zjenicu.troposferu. Razlikujemo primarnu i sekundarnu organsku proizvodnju. BIOPROIZVODNJA. Ispod rožnice je šarenica (iris) s otvorom na sredini . BIOLOŠKI INDIKATORI ONEČIŠĆENJA. bios = život. površinski sloj embrionalnih stanica koji okružuje šupljinu blastule. npr. bijela ovojnica koja obavija gotovo svu očnu jabučicu. vodozemaca (žaba). parazitizam. blastoderm. stanište. pupilarni refleks odnosno prilagodba (adaptacija) oka na svjetlo ili tamu. proizvodnja organskih spojeva tj. borovi. BLASTODERMA. To je tzv. npr. BLASTOCEL. Blastocista čovjeka i drugih sisavaca odgovara blastuli nekih beskralježnjaka. broj jedinki neke vrste ili njihova ukupna masa u suhom ili svježem stanju na nekom prostoru. npr. ježinaca i blastuli nižih kralježnjaka. blastula. Biosfera obuhvaća litosferu (površinski sloj Zemlje). BJELOOČNICA (sclera).

morske životinje iz skupine malokolutićavaca. Jela ima plosnate igličaste listove s dvije bijele pruge s donje strane. ariš i cedar. je vrsta bojanja heterotrofnih bezbojnih patogenih bakterija na temelju čega se dijele na grampozitivne i gram-negativne bakterije. velike boginje. zigote. a sastoji se od površinskog sloja stanica (blastoderma) koji okružuje šupljinu ispunjenu tekućinom (blastocel). Ariš je jedina europska listopadna četinjača. Na blastuli razlikujemo animalni pol gdje je smješten veći broj manjih stanica i nasuprot njemu vegetativni pol gdje je smješten manji broj većih stanica. Smreku prepoznajemo po pravilnoj piramidalnoj krošnji. ježinaca. Najpoznatiji su ježinci. kojim završava proces brazdanja oplođene jajne stanice. isp. v. znanstvena disciplina koja se bavi proučavanjem biljnog svijeta. Blastula ima oblik šuplje kugle. ježinca). One različito podnose tretman antibioticima. Sastoje se od okoždrijelnog prstena i 5 zrakastih žila po tijelu. To je cjevčica koja se pruža duž strana tijela. ispod ljusaka. vrlo teška zarazna bolest uzrokovana jednim iz skupine animalnih (životinjskih) virusa koji se širi dodirom ili kapljično. BODLJIKAŠI. BOČNA PRUGA. skupina meristemskih stanice raspoređenih u obliku valjaka u stabljici i korijenu pomoću kojih biljka raste u širinu (sekundarni rast). BOĆATA (brakična) VODA. BORDOŠKA JUHA. voda slanosti (saliniteta) između slatke i morske vode. Listovi su igličasti. peronospora. Bodljikaši imaju veliku sposobnost regeneracije: zvjezdača može obnoviti krakove. šešva). na grančicama poredane u dva reda. vršna ili apikalna strana na kojoj je crijevni otvor. Iz oplođenog jajeta razvija se dvobočno simetrična slobodno plutajuća ličinka pluteus. crne boginje. Ispod epiderme je unutarnji kostur od vapnenih pločica na kojem su često bodlje (npr. a češeri su uspravni. Većina ima peterozrakastu (pentaradijalnu) simetriju. Preko mnogih otvora u vezi je s okolnom vodom. zvjezdače i zmijače. te po češerima koji vise prema dolje. trpovi.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ U embrionalnom razvoju ježinaca blastoporus također nastaje na početku gastrulacije ali na vegetativnom polu blastule. Živčani i optjecajni sustavi su zrakasto raspoređeni. smješteni na kratkim ograncima. BOČNI (lateralni) MERISTEMI. a ježinac čahuru. BOGINJE (variola. kod. a u vodozemaca (žabe) na animalnoj polovici blastule. Najpoznatiji su rodovi: jela. BLASTULA. BOJENJE PO GRAMU. Primaju podražaje od strujanja vode i prenose živcima u mozak. žaba. smreka. 22 . Na tijelu se razlikuje usna ili oralna strana (uz podlogu) i suprotna. najčešće po dva. BOROVI. Dišu škrgama. oštro igličastim listovima koji su u poprečnom prerezu četverobridasti i poredani okolo čitave grančice. osjetilni organ kojim ribe osjećaju strujanje vode. Dobro je razvijen vodožilni ili ambulakralni sustav. Između bodlji nalaze se štipaljke ili pedicelarije. bor. Oplodnja je vanjska. Listovi bora su također igličasti ali su. U ježinaca se blastocel nalazi u centru blastule. npr. BOTANIKA. Spolovi su razdvojeni. Polusjedilački su oblici. porodica drvenastih biljaka iz skupine četinjača (golosjemenjače). rani oblik zametka mnogih višestaničnih životinja. U cjevčici su osjetni pupoljci sastavljeni od osjetnih stanica. Kod trpova su u koži (tjelesnoj stijenci) osikule. a nastaje njihovim miješanjem.

otkrio staničnu jezgru. kraća je njihova valna duljina. od osam šesnaest stanica itd. BROGLIE. Bubrezima se izlučuju i sve suvišne i štetne tvari produkta metabolizma (ureja. bilirubin i drugi toksini). nefron. Frekvencija pada ispod 60 otkucaja u minuti. morus) pa se taj oblik zametka naziva morula. nasljedni poremećaj izrazito kratih prstiju u ljudi. BRAKIČNA VODA. otkrio da čestice koje se gibaju velikom brzinom imaju svojstvo vala. BRADNJACI. (1773. a dišne cijevi se začepe od stalne produkcije sluzi. a posredno i u proizvodnji eritrocita. BUBREG. boćata voda. pa tijelo pri povećanom opterećenju ne dobiva dovoljne količine krvi. odnosno oko 720 mL krvne plazme. sluznice bronha i bronhiola odebljaju . u kojem se oplođena jajna stanica. dok novorođenčad imaju smanjenu. BRADIKARDIJA. v. početno razdoblje embrionalnog razvitka mnogih višestaničnih životinja. Kronični bronhitis uzrokovan je učestalim podraživanjem dišnih putova ili infektom ili drugim irititavnim čimbenicima (pušenje. upala sluznice glavnih dišnih putova (bronha i bronhiola). od četiri osam. Povećanu sedimentaciju izazivaju upale i trudnoća. malokolutićavci.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE BOTULIZAM. god. zigota dijeli brzim uzastopnim mitotičkim diobama čime se broj novonastalih stanica povećava geometrijskom progresijom. Osnivač Hrvatskog prirodoslovnog društva. v. BRAHIDAKTILIJA. Bubrezi sudjeluju i u održavanju konstantnoga krvnoga tlaka. Bronhioli završavaju proširenim plućnim mjehurićima ili alveolama. ježinaca. Služi i za održavanje homeostaze. postavio temelje razvoju biologije u nas. smrtno opasno trovanje otrovnim produktom koji luči bakterija Clostridium botulinum u loše konzerviranoj hrani ili mesu. BRUSINA S. francuski fizičar koji je 1924 god. britanski znanstvenik koji je 1831. BRONHIOLI. hrvatski zoolog. v. dušnik. a nazivamo ga blastula. manji je minutni volumen srca. R.). Tijekom brazdanja zametak najprije poprima izgled ploda duda (lat. Što je brzina gibanja čestica veća. de. od dvije stanice četiri.-1908). v. Od jedne početne oplođene jajne stanice nastanu dvije stanice. Kod akutnog bronhitisa upala je uzrokovana najčešće virusima i bolest načešće traje samo nekoliko dana. (ren). završni dijelovi sustava dušnica (bronha) u plućima. tanke cijevčice. npr. BRONHITIS. BROWN. Kašalj i iskašljavanje kod kroničnog bronhitisa traje najmanje tri mjeseca u godini i to dvije uzastopne godine. Njegovo otkriće posebno je bilo važno za izgradnju elektronskog mikroskopa. Normalna brzina sedimentacije je od 2 do 10 mm na sat. parni žljezdani organ koji izlučuje mokraću. tako što luče hormon 23 . – 1858. Posebno je proučavao recentne i izumrle mekušce. a zadaća je bubrega regulirati i održavati stalnim koncentracijske odnose ione i vode u krvnoj plazmi. L. BRAZDANJE. (1845. BRZINA SEDIMENTACIJE krvnih stanica ovisi o omjeru specifične težine krvnih stanica i specifičnoj težini plazme. Označuje ga pretjerano lučenje sluzi u bronhima. stanje usporenog rada srca. Kroz oba bubrega protječe u svakoj minuti oko 1200 mL krvi. žaba. Leže ispod ošita (dijafragme) s obiju strana kralježnice. onečišćen zrak). BOWMANOVA ČAHURA. Na kraju procesa brazdanja zametak ima oblik šuplje kugle ispunjene tekućinom.

M. C C 3 BILJKE. biljke i životinje. npr.). Osnovna jedinica građe je nefron. gljive. lišajevi) primaju vodu pretežno ili isključivo bubrenjem. stanični organeli valjkastog oblika građeni od tankih proteinskih cjevčica tzv. Kao pojedinačna valjkasta tjelešca vidljivi su tek elektronskim mikroskopom. CAM BILJKE (biljke s dnevnim kiselinskim ritmom). najviša i najšira jedinica u raspoređivanju živih organizama. v. CALVINOV CIKLUS. Celom postoji u razvijenih beskralježnjaka. počinju se razvijati iz sitne krute čestice koja se istaloži u bubrežnoj nakapnici uz koju se nakupljaju različiti minerali. otkrio puteve ugljika tijekom fotosinteze. CELULOZA. počinju sa spojem koji ima četiri atoma ugljika. isp. biljke koje noću primaju CO2 i ugrađuju ga u organske kiseline. Opća formula celuloze je (C6H10O5)n. protisti. filogenetski sustav. (rođ. C 4 BILJKE. biljke u kojih prvi stabilni spoj koji nastaje u sekundarnim reakcijama fotosinteze (Calvinov ciklus) sadržava tri atoma ugljika.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ eritropoetin koji stimulira koštanu moždinu.. kaktusi. BUBRENJE. CANIS LUPUS. Nalaze se u citoplazmi svih životinjskih stanica i nekih alga. u bodljikaša. spojevi kalcija. Dolaze u paru. Ulaženje vode povećava unutarnji tlak stanice. američki biokemičar. vodozemaca. Postigao rezultate koji su potvrdili rezultate Millera. gmazova. noću otvorene). a danju ga otpuštaju i upotrebljavaju u Calvinovom ciklusu. CARSTVO. fizički proces. turgor. BUBREŽNI KAMENCI. ptica i sisavaca). kemijski spoj koji nastaje međusobnim spajanjem 8 do 12 tisuća molekula šećera (saharida) glukoze pa stoga spada u skupinu polisaharida. pričvrsnica. stručni latinski naziv za vuka. Neki biljni dijelovi (npr. sjemenke) ili čitavi biljni organizmi (npr. oblik tjelesne šupljine koja se razvija za vrijeme embrionalnog života. a obavijena je stanicama mezoderma. pa kamenac postaje sve veći. sposobnost krutih tvari da upijaju vodu i pritom povećavaju volumen. CALVIN. djelomice i u mekušaca te u svih kralježnjaka (riba. npr. Neki biolozi razvrstavaju organizme u dva osnovna carstva: biljno i životinjsko. CELOM (sekundarna tjelesna šupljina). CENTRIOLI. fotosinteza 24 . biljke u kojih sekundarne reakcije fotosinteze (Calvinov ciklus). tzv. odnosno sinteze ugljikohidrata. 1911. CENTROMERA. a neki prema suvremenijim shvaćanjima u pet carstva: monera.). kolutićavaca. Bubrenjem stanice mogu samo ograničeno primati vodu jer su obavijene čvrstom celuloznom stijenkom. Isp. BULBILI. člankonožaca. npr. mikrotubula. v. Izgrađuje glavninu staničnih stijenki biljnih stanica. Isp. rasplodni pupovi koji nastaju u pazušcu ili na rubu lista. smješteni jedan u odnosu na drugi pod pravim kutom izgrađujući centrosom (isp. vegetativno razmnožavanje. CAM biljke su sukulentne biljke prilagođene životu na suhim staništima (puči su danju zatvorene kako bi smanjile transpiraciju. Bubrezi su sastavljeni od vanjske kore i srži raspoređene u piramide.

To su: svjetlosna mikroskopija. modrozelene alge. aktivnost određenih enzima. v. CITOPLAZMATSKO NASLJEĐIVANJE. CERKARIJE. Svojim velikim perastim listovima sliči palmi. tetanusa. On daje stanici mehaničku strukturu. CITOKROMI. Oplodnja se zbiva pokretnim muškim gametama. gubitak težine. pojava obavijanja mladih vitica oko podloge zbog nejednakog rasta gornje i donje strane vitica. CITOPLAZMA. stara i razvojno primitivna golosjemenjača. bolest postupnog propadanja funkcionalnog tkiva jetre. CIKLUS LIMUNSKE KISELINE. znanost koja proučava građu i funkciju stanice. Kod biljaka npr. spermatozoidima. Krebsov ciklus. kultura stanica i tkiva i dr. Prisutni u svih eukariota. omogućuje 25 . dioba stanične plazme koja uslijedi nakon diobe jezgre u mitozi i mejozi. skupina biljnih hormona koji stimuliraju diobu stanica. ovčji metilj. Najčešći uzrok ciroze u razvijenim zamljama je alkoholizam. CITOSKELET. CIROZA JETRE. bjelančevine koje sadržavaju željezo. Pod svjetlosnim mikroskopom centrosom se vidi kao svijetlo zrnce.) Nalazi se u citoplazmi svih životinjskih stanica i stanica nekih alga. mučnina. CIRKUMNUTACIJA.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE CENTROSOM. CITOLOŠKE METODE. Najvažnije spoznaje s područja citologije dobijene su upotrebom svjetlosnog i elektronskog mikroskopa. Obvezno cijepljenje se u Hrvatskoj provodi već godinama protiv tuberkuloze. difterije. dio transportnog lanca elektrona u mitohondrijima i kloroplastima. sustav tankih proteinskih vlakana i cjevčica u citoplazmi. loša probava i nadutost. može potpuno zatajiti funkcija jetre sa smrtnim ishodom. rubeole. embriji i plodovi. ali su zadržali svoju antigeničnost (sposobnost imunizacije). opća slabost. djeluju na sazrijevanje kloroplasta i sudjeluju u kontroli apikalne dominacije. znanstvene metode koje se primjenjuju u istraživanjima građe i funkcije stanica. pravilni fiziološki ciklusi koji se ponavljaju u periodima od oko 24 sata. CIJEPLJENJE. Javljaju se izostanak apetita. hripavca. dlečje paralize i ospica. CITOKININI. CITOLOGIJA. nasljeđivanje osobina koje su determinirane izvankromosomskim genima koji se nalaze u citoplazmatskim organelima kao što su mitohondriji i kloroplasti. povraćanje. osnovna tekuća faza stanice u kojoj se nalaze organeli. unašanje u organizam uzročnika bolesti ili njihovih produkata koji su izgubili patogeničnost (ne uzrokuju pojavu bolesti). periodično gibanje listova (danji i noćni položaj). CIKAS. elektronska mikroskopija. kemijski spoj iz skupine aminokiselina. CIRKADIJSKI RITMOVI (lat circa = približno. Ima važnu ulogu u procesu diobe stanice gdje sudjeluje u formiranju diobenog vretena. Kod osoba koje se ne mogu odreći alkohola. autoradiografija. CIJANOBAKTERIJE. odgađaju starenje. odvijanje procesa fotosinteze i disanja. stanični organel izgrađen od dva centriola (isp. CISTEIN. CITOKINEZA. utječu na diferencijaciju. dies = dan). v. Sintetiziraju se u tkivima koja aktivno rastu kao što su vrškovi korijena. puči i latica. Podrijetlom je iz istočne Azije. v.

sadrže i druge boje osim klorofila. posebno crveni pigment. Ocvijeće čiji listovi izgledaju jednako zove se perigon. Te im boje omogućuju kromatsku adaptaciju. Uzrokuju slabokrvnost. Nametnici mogu biti oblići (Nematodes) i trakavice (Cestodes). Sastoji se od cvjetne stapke. Odlikuju se posebnim oblikom razmnožavanja. može živjeti nametnik obična ili dječja glista (Ascaris lumbricoides). floridejski škrob (produkt fotosinteze) itd. v. CVIJET. lijekovi kemijske proizvodnje koji se koriste u liječenju zloćudnih bolesti (kemoterapiji). cvjetištu. v. mučninu i grčeve crijeva. U tankom crijevu. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina. insekticid (zamjena za DDT). Kod selagine u izmjeni generacija sudjeluju dvovrsne spore i dva različita gametofita (muški i ženski). bez bičeva. Po obliku razlikujemo: glavicu. žuto tijelo. Trakavice nastanjuju pretežno tanko crijevo. CRVENE ALGE. CROSSING OVER. CORPUS LUTEUM. opisao strukturu molekule DNA. ocvijeća. Oblik cvata često karakterizira cijele porodice cvjetnica. osobito djece. da ga mijenja. klas. CVAT. cvjetišta. grozd. resu. Crvene alge roda Lithothamnion talože u svoje stijenke vapnenac pa je kao rezultat nagomilavanja u slojeve nastao litotamnijski vapnenac. fikoeritrin. CRIJEVNI NAMETNICI. generativni organ biljke kritosjemenjače. god. da se pomiče itd. U crnogoričnim šumama raste prava crvotočina. v. v. nametnici koji mogu s hranom dospijeti u čovjekovo probavilo u obliku jaja ili ličinke. isp. CRNE BOGINJE. (v. tj. povraćanje. C C H H 26 . Osim puzajućih stabljika imaju uspravne ogranke koji završavaju češerićima sa sporangijima i sporama. bijelo tijelo. Vrijeme cvatnje je produženo jer svi cvjetovi jednog cvata ne cvatu istovremeno. boginje. štitac i gronju itd. a selagina ispod grmova u primorskim krajevima. shematski crtež češćih cvatova). Iz crvenih alga dobiva se agar. krosingover. biljke iz skupine papratnjača. (rođ. NH2 N O C C N H CORPUS ALBICANS. Listovi vjenčića su latice. CRVENE KRVNE STANICE.. Cvijet se nalazi na zadebljanom kraju cvjetne stapke. Može biti razlučeno u čašku i vjenčić. skupina cvjetova na zajedničkoj cvjetnoj stapci. CRICK. Čaška se najčešće sastoji od zelenih listova (lapovi) koji prvenstveno štite cvjetni pup. osnovna vodena koloidna otopina stanice koja preostane nakon odvajanja organela centrifugiranjem. CITOZIN.).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ joj da zadrži svoj oblik. Ocvijeće zaštićuje tučak i prašnike te primamljuje kukce oprašivače. organski spoj s dušikom iz skupine pirimidinskih baza. F. CITOSOL. prašnika i tučka. spolnog gametama i nespolnog sporama pri čemu su rasplodne stanice uvijek nepokretne. 1916. Najčešće su goveđa (Taenia sagata) i svinjska (Taenia solium) trakavica. eritrociti i krvna tjelešca CRVOTOČINE. v. britanski fizičar koji je zajedno s američkim biologom Watsonom 1953. isp. To upućuje na srodnost s modrozelenim algama. CITOSTATICI.

duodenalni ulkus. jaju vodozemaca. 6-klip. porodica biljaka iz skupine četinjača (golosjemenjače).štitac. s nekoliko stotina vrsta najzastupljenija skupina golosjemenjača. U hrvatskoj flori zastupljene su s oko dvadesetak vrsta unutar porodica: borovi. 7. većina sadrži smolu. Perigon i vjenčić mogu biti različito obojeni (ako se oprašuju kukcima) ili neugledni ako se oprašuju vjetrom. Cvjetovi su jednospolni. Drvenaste biljke. Ženski cvjetovi sastoje se od plodnih (sjemenih) ljusaka sa "golim" sjemenim zamecima jer nisu zatvoreni unutar plodnice. Listovi su uglavnom tvrdi. npr. više od 80 m). 2-sastavljeni grozd. 3-gronja. drvenasti i okruglasti. čempresi i tise. 5-sastavljeni klas. U nekih kritosjemenjača cvjetovi dolaze pojedinačno. kao stabla (ponekad vrlo visoka) ili grmovi. a drugih sulatičan (od sraslih latica). Č ČEMPRESI. Među četinjače pripadaju i najstarija drveća na svijetu (mamutovci. 9-glavica 27 . Biljke na kojima se razvijaju i ženski i muški cvjetovi nazivaju se jednodomne biljke. a muški su prašnici. a sastoje se od prašničkih listova s peludnicama (mikrosporangijima). Poslije oplodnje razvija se sjemenka. Češeri čempresa i tuje su tvrdi. a ženski češer postaje tvrd i drvenast. ozlijeđeno mjesto na sluznici dvanaesnika. To su stabla ili grmovi s igličastim ili ljuskavim listovima. ČIR DVANAESNIKA. Vjenčić je mnogih cvjetova prostolatičan. Dvodomne su biljke one koje imaju samo muške ili samo ženske cvjetove. a u drugih su skupljeni u cvat. sočne češeriće koje sliče na bobu i zovu se pupuljice. ČETKASTI KROMOSOMI (lump brush kromosomi. a građene su od DNA. 4-klas. Ovamo ubrajamo: čempres. 8sastavljeni štitac. igličasti ili ljuskavi. Najčešće dolaze u okviru šumske vegetacije sjeverne polutke. Muški su u obliku resa. Najčešći uzrok nastanka čira na dvanaesniku je djelovanje kloridne kiseline koja 1 2 3 4 6 5 7 8 9 Shematski crteži češćih cvatova: 1-grozd. ČETINJAČE. u pravilu vazdazeleni. kromosomi s petljama). Borovica ima mesnate. do 4000 godina) te najviša stabla (sekvoje. S takvih kromosoma protežu se bočno niti koje se šire u petlje. borovicu i tuju. Ženski je dio cvijeta tučak. kromosomi specifičnog izgleda koji se vide za vrijeme diobe stanice i to u profazi mejoze I u mnogih organizama. obično maleni i mekani. Cvjetovi su po izgledu višesimetrični ili jednosimetrični. Cvjetovi mogu biti dvospolni (imaju i tučak i prašnike) ili jednospolni (imaju ili tučak ili prašnike).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE a listovi tepala.

U težim slučajevima može nastati krvarenje iz čira. skup genetičkih vrlo sličnih jedinki koje su nastale samooplodnjom jednog roditeljskog organizma. ČIR ŽELUCA. kukavica. Tijelo je pokriveno hitinskom kutikulom. Da- 28 . teže ozlijeđeno mjesto u sluznici želuca. Žene imaju 44 autosoma i 2 x spolna kromosoma. Uzroci su uglavnom isti kao oni koji dovode do gastritisa. a 2 spolni kromosomi. ČLANKONOŠCI (Arthropoda). repaši. poremećaj vida u kojem je očna jabučica prekratka. Živi u podzemnim vodama krškog područja i poznati je naš endem. peptički ulkus. Čir dvanaesnika češći je u pušača cigareta. sokolovki) koji se izlegu slijepi. bez perja i nesposobni za samostalni život. mladunci nekih vrsta ptica (npr. često pojačanom vapnencem. Njih roditelji moraju hraniti sve dok ne napuste gnijezdo. Za izlučivanje služe ticalne žlijezde (preobraženi metanefridiji) ili Malpighijeve cjevčice. Poznate su posljedice pogrešnog broja spolnih kromosoma: individue sa samo 1 x spolnim kromosomom bez para (xo) su ženske. D DALEKOVIDNOST (hipermetropija. golubova. U tjelesnim stanicama čovjeka ima 46 kromosoma (diploidan broj) od kojih su 44 autosomi (ne određuju spol). U staništima s temperaturom ispod 15 oC rađa žive mlade dok u toplijoj vodi odlaže jaja. Kod čira želuca javlja se tupa žareća bol u gornjem dijelu trbušne šupljine. veći ili manji od navedenog što uzrokuje pojavu različitih anomalija pa i smrti. Osnovno obilježje su člankovite noge. Kolutići su se stopili u (dvije ili tri) cjeline: glavu. Takvi se slučajevi pojavljuju gotovo isključivo u biljaka. svi kromosomi pojedine stanice čovječjeg organizma. Najbrojnija životinjska skupina kojoj pripadaju: klještari. Optjecajni sustav je otvoren. ptica pjevica. KROMOSOMSKA GARNITURA. ČOVJEK. prsa i zadak. te je neoštra. ali nerazvijene i neplodne. ČISTA LINIJA. Dišni pigment je hemocijanin. Tako ženske gamete ili jajne stanice sadrže 22 autosoma i 1 x spolni kromosom. korijen. U gametama ili spolnim stanicama čovjeka nalaze se 23 kromosoma (haploidan broj) od čega su 22 autosoma i 1 spolni kromosom. Živčani sustav je ljestvičav. 1 x i 1 y spolni kromosom. beskralješnjaci iz skupine malokolutićavaca. ČOVJEČJA RIBICA. a muškarci 44 autosoma. Pri akomodaciji leće. odnosno vanjskim kosturom ili egzoskeletom (npr. Imaju vanjske škrge koje se zadrže tijekom čitava života. ČUPAVO KORIJENJE. Javljaju se boli i grčevi u trbušnoj šupljini. ali neplodne i s nešto ženskih osobina. vodozemac iz skupine repaša. Individue s xxy spolnim kromosomima su muške.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ himusom prelazi iz želuca u duodenum. kao i u osoba s pojačanim izlučivanjem kiseline u želucu (hiperaciditet). v. kod rakova). Dišu škrgama i uzdušnicama (trahejama). koža joj je blijeda. a muške gamete ili spermiji sadrže 22 autosoma i 1 y spolni kromosom ili 22 autosoma i 1 x spolni kromosom. tj. hiperopija). a oči zakržljale. v. Najvažnija osjetila su ticala i oči. ČUČAVCI. Nastanjuju sva moguća staništa. Razdvojenog su spola. slika pada iza mrežnice. Zbog stalnog boravka u mraku. rakovi i uzdušnjaci (stonoge i kukci). Broj kromosoma može biti i nenormalan.

M.F. DEBELO CRIJEVO. te oba plina odlaze u zrak (atmosferu). a strukturne: HOCH2 H H O H OH OH H H Izgrađuje nukleotide dezoksiribonukleinske kiseline (DNA). DAŽDEVNJACI. Suprotan proces je plazmoliza. DEM.u muljevitom i u vodom natopljenom tlu. te refleksnog i kontroliranog pražnjenja crijeva (defekacija). (1809. te bakterijskog truljenja ostataka neprobavljene hrane. ali bez crijevnih resica i s manje žljezdanih stanica. znanost o kretanju broja stanovnika na Zemlji. zaslužan za industrijsku proizvodnju antibiotika. DEPLAZMOLIZA. Stijenke debelog crijeva građene su poput stijenki tankog crijeva. i DAVSON. DDT. predložili model membrane prema kojem se dvosloj lipida nalazi između dva sloja bjelančevina.A. Proces se odvija djelovanjem bakterija.A. Dijeli se na početni dio ili slijepo crijevo (caecum) na kojem se nalazi crvuljak (apendix). nitrifikacija.. v. H. inaktiviranje štetnih produkata probave (indol. DNA. DAVSON. H. a najveća količina se prenosi u obliku karbonatne kiseline. mutacija nastala gubitkom dijela kromosoma. mjesto niže koncentracije vode. DEMEREC. proces kojim se amonijak (koji nije pretvoren u nitrate procesom nitrifikacije) cijepa na slobodni dušik i vodik. repaši. J. npr. DEOKSIGENIRANA KRV (reducirana krv). voda ulazi u stanicu i vakuolu. skatol). – 1882. reapsorpcije vode i minerala. DARWIN. J. Kada je stanica u hipotonočnoj otopini. cjevasti organ probavnog sustava.F. DEMOGRAFIJA. formiranje i nakupljanje stolice (feces). (1895. DANIELLI. dezoksiriboza. sljepoća na boje. DALTONIZAM. živčana stanica. Ch. v. DECIDUA STANICE. dugačko je 1. DENDRITI. nastavak tankog crijeva. v.). engleski prirodoslovac. krv koja transportira ugljikov dioksid prema plućima. 29 . v. sinteze vitamina. tj. hrvatski genetičar. kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O4. DENITRIFIKACIJA. DELECIJA. dio je vezan na globinski dio molekule hemoglobina kao karbaminohemoglobin. Danielli. v.. diklor-difenil-trikloretan.5 do 2 metra. DEZOKSIRIBOZA. v. v. – 1966. god.. stanice vanjskog sloja sluznice maternice koje sadrže hranjive tvari potrebne za razvitak zametka u ranim stadijima embrionalnog razvitka.). vrsta. fenol. utemeljitelj selekcijske teorije evolucije. znanstvenici koji su 1936. Ugljikov dioksid se transportira na tri načina: mala količina je otopljena u krvnoj plazmi. insekticid. lučenja sluzi.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE lekovidnost se ispravlja konveksnim lećama (pozitivna dioptrija). zatim na kolon (colon) i završava završnim crijevom (rectum) i čmarom (anus). koji se rodiou SAD. Aktivnost debelog crijeva sastoji se od primanja himusa iz tankog crijeva. DEOKSIRIBOZA. naročito nekih anaerobnih. DEZOKSIRIBONUKLEINSKA KISELINA. DENITRIFIKACIJA. v. pojava povećavanja obujma vakuole te potiskivanje protoplasta prema staničnoj stijenci.

F2. u biljaka iz meristemskih (embrionalnih) stanica nastaju stanice epiderma. a recesivni samo ponekad (u slučaju homozigotnosti). Epitelna. odnosno proces kada se od istih početnih stanica postupno razvijaju različite vrste stanica (po obliku. svaka od diferenciranih stanica ima u sebi aktivnu samo malu. proces usvajanja raznolikosti među identičnim stanicama. živčana i druge diferencirane stanice nose iste gene kao i stanica (zigota) od koje su nastale mitotičkim diobama. Primjer: Dihibridno križanje pjegavog crnog i jednobojnog smeđeg goveda gdje su aleli za crnu boju i za jednobojnost dominantni. DIJASTOLA. Dobivamo 9 crnih i jednobojnih jedinki. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. ali različitu skupinu gena koja određuje njezinu specifičnu građu i funkciju. za jedno svojstvo A i a. jedna od vrsta križanja (isp. koštane. U ovom slučaju u P generaciji stvaraju se dvije vrste gameta. DIFERENCIJALNA AKTIVNOST GENA. Naime. F3 itd. aB. U F1 generaciji stvaraju se 4 vrste gameta (AB. Ova pojava tumači na koji način stanice koje u sebi imaju iste gene mogu biti po svom obliku i funkciji potpuno različite. DIJALIZA. Njezinu praktičnu primjenu nalazimo pri liječenju teških bubrežnih bolesnika kojima se kroz umjetne probirne membrane u hemodijalizatoru (umjetni bubreg) iz krvi izdvajaju samo relativno male molekule štetne uree. Za svako svojstvo postoje dominantni i recesivni aleli. pojava aktivnosti samo male specifične skupine gena u nekoj stanici. DIFERENCIJALNA KRVNA SLIKA (DKS). razdoblje kada je srce u relaksiranom stanju pa se klijetke pune krvlju. a jedinke u oba svojstva homozigotne (isp. smeđe pjegavo govedo.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ DIFERENCIJACIJA STANICA. proces gibanja čestica neke tvari iz područja njihove veće koncentracije u područje manje koncentracije do izjednačavanja koncentracije. a recesivni malim. šećerna bolest. v. Ab i aB.) u kojem se prati nasljeđivanje dvaju svojstava. U F3 generaciji. DIJAFIZA. (v. DIHIBRIDNO KRIŽANJE S DOMINACIJOM. stanice zapornice itd. Ab. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima. funkciji i molekulskom sastavu) koje se tako specijaliziraju za točno određenu funkciju u složenom biljnom i životinjskom organizmu. krvne i druge stanice. unatoč velikom broju gameta. kost. ab). Dominantni dolaze uvijek do izražaja u fenotipu.). živčane.. broj fenotipova se ne povećava. a generacije potomaka (filijal- ne) prema redoslijedu s F1. Isp. sitaste stanice. postupak razdvajanja tvari kada molekule jedne otopljene tvari iz područja veće koncentracije prelaze u područje manje koncentracije kroz polupropusnu membranu kroz koju ne mogu proći molekule druge tvari. v. a u životinja diferencijacijom nastaju epitelne. a za drugo svojstvo B i b. DIFUZIJA. korijenove dlačice. a sve jedinke F1 generacije su crne i jednobojne (AaBb) jer se geni za vrstu i raspored boje nasljeđuju nezavisno jedan o drugome. leukociti. sastav različitih vrsta leukocita u krvi. mišićna. shemu u Dodatku 1) DIJABETES. npr. a njihovim međusobnim križanjem u F2 generaciji (tablični prikaz) nastaje 4 različita fenotipa u omjeru 9:3:3:1. 3 smeđe i jednobojne jedinke i 1 jedinka potpuno novog fenotipa. 3 crne i pjegave jedinke. 30 . Tako.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

DIJASTOLIČKI TLAK, tlak koji preostaje nakon prolaska sistoličkog tlaka (isp.) kroz arterije. DIJATOMEJSKA ZEMLJA, v. kremenjašice. DIKTIOSOMI (grč. diktyion – mreža i soma – tijelo), sastavni dijelovi Golgijeva tijela. Građeni su od plosnatih šupljina (Golgijevih cisterni) naslaganih jedna iznad druge, a odvojenih membranama. Promjer im je oko 1 μm. Na rubovima su šupljine proširene i od njih se odvajaju Golgijevi mjehurići obavijeni membranom. DIOBENO VRETENO, organizirani niz mikrotubula (sitnih proteinskih cjevčica) koje svaraju centrioli za vrijeme diobe stanice (mitoze, mejoze). Njegova je uloga da veže kromosome i omogući njihovo razdvajanje i kretanje prema suprotnim polovima stanice. DIPLOIDNA GENERACIJA, v. haploidna generacija. DIPLOIDNE STANICE, stanice koje imaju dvostruki broj ili diploidan broj (2n) kromosoma. Kromosomi u takvim stanicama smješteni su u homologne parove gdje je svaki član para nasljeđen od jednog roditelja. Diploidne stanice su sve tjelesne stanice onih organizama koji su nastali od dvaju roditelja oplodnjom. Takve stanice dijele se mitozom odnosno staničnom diobom koja omogućuje stvaranje novih stanica s jednakim, konstantnim brojem kromosoma koji je karakterističan za svaku vrstu. DIPLOIDNI BROJ KROMOSOMA (dvostruki broj kromosoma), se javlja u stanicama biljaka i životinja i to tako da kromosomi uvijek dolaze u parovima, tzv. homolognim parovima. Jedan član para podrijetlom od oca, a drugi član para od majke, npr. tjelesne stanice čovjeka imaju

23 para, tj. 46 kromosoma, 23 od oca, 23 od majke (2n=46, n=23); stanice vinske mušice imaju 8 kromosoma (2n=8, n=4), psa 78 (2n=78, n=39), konja 60 (2n=60, n=30), čimpanze 48 (2n=48, n=24), kukuruza 20 (2n=20, n=10), rajčice 24 (2n=24, n=12), kruške 34 (2n=34, n=17) itd. DIPLOKOKI, v. bakterije. DISAHARIDI, v. ugljikohidrati. DISANJE (respiracija), Postoje dva oblika disanja, stanično i vanjsko disanje. Stanično disanje (biološka oksidacija) je proces koji se odvija u biljnim i životinjskim stanicama, a u kojem se organski spojevi, uz prisutnost enzima disanja, postupno oksidiraju do ugljik(IV) oksida (ugljikovog dioksida) i vode pri čemu se oslobađa velika količina energije. 56 % energije se oslobodi u obliku topline, 46 % se pohranjuje u molekulama ATP-a. Energija oslobođena staničnim disanjem koristi se za sve životne aktivnosti stanice. Najčešći i najvažniji organski spojevi koji su

Stanično aerobno disanje

31

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

izvori energije u stanici su ugljikohidrati, zatim masti, a u manjoj mjeri i proteini. Disanje možemo grubo predočiti kemijskom jednadžbom:

C6H12O6 + 6O2 → 6CO2 + 6H2O + + energija
Stanično disanje je vrlo složen proces koji se u većine organizama može podijeliti na anaerobnu i aerobnu fazu. Anaerobnu fazu disanja čini glikoliza, a aerobnu fazu Krebsov ciklus ili ciklus limunske kiseline i oksidativna fosforilacija. Vanjsko disanje je proces izmjene plinova (O2 i CO2) između vanjske sredine, zraka ili vode, i organizma. Ovaj oblik disanja odvija se u različitim organima za disanje, npr. plućima, škrgama, koži itd. DIŠNI (respiratorni) SUSTAV, zajedno s krvožilnim omogućuje svim stanicama tijela izmjenu plinova, dobivanje potrebnih količina kisika i odstranjivanje ugljikova dioksida. Sastoji se od gornjih dišnih putova (nosa, ždrijela i grkljana) i donjih dišnih putova (dušnika, dušnica i pluća). DIURETICI, sredstva koja ubrzavaju i povećavaju odstranjivanje mokraćom viška vode iz tijela. Smanjujući volumen vode u krvi, snizuju krvni tlak. Diuretici inhibiraju lučenje antidiuretskog hormona (ADH), isp. DIUREZA, povećano lučenje vode tj. odstranjivanje viška vode iz tijela mokrenjem. DIURNALNE ŽIVOTINJE, v. dnevne životinje. DIVERGENTNA EVOLUCIJA (račvasta, specijacija u užem smislu riječi), evolucijski razvoj koji vodi k nastajanju nekoliko novih vrsta u kojih su populacije prostorno odvojene jedna od druge. U svakoj odvojenoj populaciji može se događati sukcesivna evolucija.

DIZENTERIJA (srdobolja, griža) je crijevna zarazna bolest praćena proljevom (dijarea) i bolovima u trbušnoj šupljini s inkubacijom 2 do 7 dana. Najčešći uzročnik je bacil roda Shigellae koji napada sluznicu debelog crijeva. Ako je dizenterija uzrokovana amebama tada govorimo o amebnoj dizenteriji. DJEČJA GLISTA, nametnik u crijevu čovjeka. Pripada oblićima, skupina oblenjaci, isp. Anaerobionti su. Tijelo je dužine i do 50 cm. Razdvojenog su spola. Tijelo mužjaka je manje i zavinuto na stražnjem dijelu. Rasplodni su im organi neparni cjevasti sjemenik i sjemenovod. Ženke imaju parne cjevaste jajnike, jajovode i plodnice (maternica ili uterus) i oplodnja je unutarnja. Oplođena jaja ženka izbacuje u crijevo domadara. Čovjek se zarazi prljavim rukama te jedući neoprano voće i povrće. DJEČJA PARALIZA (polio, poliomyelitis, poliomijelitis), zarazna bolest koju uzrokuje životinjski (animalni) virus, poliovirus koji napada središnji živčani sustav i izaziva klijenut (paralizu) udova. DJEVIČANSKI ZALISTAK, v. himen. DLAKE, rožnate tvorevine kože koje pokrivaju tijelo sisavaca i štite ih od gubitka topline. Većina sisavaca ima pokrivne dlake ili osje koje su čvršće i veće, a ispod su manje i slabije dlake tzv. malje. Dlake su građene od dlačnog korijena sastavljenog od dlačnog stručka i dlačne glavice. Uložene su u dlačne mješčiće t.j. uvrate pousmine u usminu. Svaka dlaka ima svoj dlačni mišić tako da se sisavci mogu nakostriješiti. Dlake mogu biti preobražene u čvrste četine (kod npr. svinje) ili u bodlje (kod npr. ježa i dikobraza). DNA (DNK, dezoksiribonukleinska kiselina), organska makromolekula koja se nalazi u jezgri stanice, u mitohondrijima i

32

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

plastidima. DNA se sastoji od dva polinukleotidna lanca koji su nastali povezivanjem velikog broja nukleotida kao osnovnih građevnih jedinica nukleinskih kiselina. Svaki nukleotid DNA građen je od triju vrsta molekula: šećera dezoksiriboze, fosfata i jedne purinske baze (adenin ili gvanin) ili pirimidinske baze (timin ili citozin). Nukleotidi u jednom lancu međusobno se vežu tako da se fosfat jednog veže sa šećerom drugog nukleotida, a dva polinukleotidna lanca se vežu međusobno preko dušičnih baza vodikovim vezama. Purinska baza jednog lanca uvijek se veže s odgovarajućom pirimidinskom bazom drugog lanca. Polinukleotidni lanci su spiralno zavijeni oko zamišljene središnje osi tako da molekula DNA izgleda poput dvostruke zavojnice (heliksa) čiji je promjer 2 nm. DNA je jedina organska molekula koja ima sposobnost umnožavanja ili replikacije i to na taj način da od jedne ishodišne molekule DNA nastanu dvije potpuno jednake molekule. Način umnožavanja DNA zovemo polukonzervativno udvostručavanje, zbog toga što je u sastavu novonastalih molekula DNA jedan lanac “stari”, odnosno potječe od ishodišne molekule, a drugi lanac je novoizgrađen i to prema kalupu starog.
p
HN H O H N N H 2COH N

nositelj nasljeđivanja, a odgovorna je i za sintezu proteina. DNEVNE (diurnalne) ŽIVOTINJE (diurna, lat. dies = dan), životinje koje su danju aktivne. To je većina životinja, npr. većina kukaca, ptica i sisavaca. DNEVNO NEUTRALNE BILJKE, biljke na čije cvjetanje ne utječe fotoperiod (npr. krastavac i kukuruz). DNK, v. DNA DOJENJE, izlučivanje mlijeka iz žljezdanih stanica dojke kao reakcija na podražaj djeteta pri sisanju. Hormoni koji omogućuju dojenje su prolaktin i oksitocin. Prolaktin se izlučuje u velikim količinama u adenohipofizi (prednjem režnju hipofize) kao reakcija na smanjenu količinu estrogena i progesterona u krvi majke, a koja se smanjuje zbog gubitka posteljice nakon rođenja djeteta. Pri sisanju dijete podražuje osjetilna tjelešca u bradavici dojke i ti podražaji dolaze do hipotalamusa koji luči specifične neurohormone koji pak neurohipofizu potiču na lučenje oksitocina. Oksitocin u dojkama uzrokuje stezanje mjehurića punih mlijeka i potiskivanje mlijeka u kanaliće dojki do bradavica. U prvih nekoliko mjeseci dojenja obično izostaje menstrualni ciklus. DOMINANTNE VRSTE u biocenozi, vrste koje prevladavaju brojnošću ili biomasom. Te su vrste najbolje prilagođene uvjetima biotopa, kao npr. hrast u hrastovoj šumi. DOMINANTNO SVOJSTVO (prevladavajuće svojstvo), svojstvo koje u nasljeđivanju uvijek dolazi do izražaja. U literaturi, dominantna svojstva se označavaju velikim slovima. DORMANCIJA (stanje mirovanja), razdoblje u kojem je rast biljaka ili nekih

D
p

N

CN
O H

G
N

D
p

O H N H H NH N

C H3

D

N

TN
O

A
N

N

D
p

D = dezoksiriboza, C = citozin, G = gvanin, T = timin, A = adenin, P = fosfatni ostatak

DNA je jedna od najvažnijih staničnih makromolekula jer izgrađuje gene te je

33

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

njezinih dijelova privremeno prekinut ili jako usporen. Razlikujemo nametnutu ili prisilnu dormanciju (izravno ovisi o nepovoljnim okolišnim uvjetima) i prirođenu ili endogenu dormanciju (uzroci su u samoj sjemenci ili pupu; npr.stvaranje zimskih pupova). DOWNOV SINDROM (mongolizam), poremećaj izazvan trisomijom (na 21. kromosomu tri kopije kromosoma). DRIFT (genska snaga, genska slučajnost), jedna od pokretačkih sila evolucije. To je pojava kada neki mutirani recesivni gen u populaciji može doći do izražaja u potomstvu ili se može izgubiti ne pojavivši se više u potomstvu. Genska snaga učestala je pojava u malim populacijama. DRIOPITEKUS (Dryopithecus), šumskog pramajmuna čiji su ostaci na više mjesta u Europi, Aziji i Predstavlja ishodišnu skupinu za čovjekolikih majmuna (čimpanza, orangutana). oblik nađeni Africi. razvoj gorila,

ili Mullerova cijev koja u ženke preuzima ulogu jajovoda, a kod mužjaka zakržlja. DUCTUS DEFERENS, v.sjemenovod. DUODENUM, v. dvanaesnik. DUŠIČNE BAKTERIJE, v. dušikove bakterije. DUŠIČNE BAZE, organski dušikovi spojevi koji sudjeluju prvenstveno u izgradnji nukleotida odnosno nukleinskih kiselina i ATP-a. Postoje purinske (adenin i gvanin) i pirimidinske (timin, citozin, uracil) dušične baze. DUŠIKOVE (dušične, nitrificirajuće) BAKTERIJE, fiksatori atmosferskog dušika. Različite autotrofne kemosintetske bakterije koje žive slobodno u tlu. (Azotobacter) ili u simbiozi s višim biljkama. U korijenskim gomoljićima mahunarki nalaze se simbiotske bakterije roda Rhizobium. Bakterije uzimaju dušik iz zraka i pretvaraju ga u amonijeve ili nitratne spojeve koje biljke mogu koristiti za izgradnju svojih aminokiselina, proteina i nukleinskih kiselina. Imaju i sposobnost pretvaranja amonijaka, koji nastaje raspadanjem uginulih organizama, do nitrata. DUŠNICA, v. uzdušnice. DUŠNIK (trachea), cijev koja je u u čovjeka duga oko 12 cm, a u stijenci ima hrskavične prstenove. Grana se u lijevu i desnu dušnicu (bronhi) koje ulaze u lijevo odnosno desno plućno krilo. Dušnice se u plućima granaju u bronhiole koje završavaju plućnim mjehurićima. DVANAESNIK (duodenum), početni dio tankog crijeva, isp. U njega se ulijevaju izvodni kanali jetre i gušterače kojima se u crijevo dovode žuč i gušteračin sok. DVOBOČNA (bilateralna) SIMETRIJA, simetrija kod koje se tijelo može podijeliti jednom ravninom na lijevu i desnu po-

DROSOPHILA MELANOGASTER, v. vinska mušica. DRUGA MEJOTIČKA DIOBA, v. mejoza II. DRUGI BUBREG (prabubreg ili mezonefros), parni organ tamnocrvene boje, služi za izlučivanje kod riba i vodozemaca. Kod riba je smješten uz kralježnicu iznad plivaćeg mjehura, a kod vodozemaca na leđnoj strani stražnjeg dijela tjelesne šupljine. Klupka krvnih kapilara (glomeruli) se spuštaju u lijevke koje zovemo Bowmanova čahura. Predbubrežna cijev (v. prvi bubreg) se podijeli po dužini u dvije. Jedna od njih postaje prabubrežna ili Wolfova cijev, koja u mužjaka služi kao mokraćovod i sjemenovod, a u ženke samo kao mokraćovod. Druga ostaje predbubrežna

34

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

lovicu. Bilateralno simetrične životinje su pokretne. DVODIHALICE, stara skupina riba (iz devona), živi fosili. Pripadaju skupini nosnoprolaznica, isp. Plivaći se mjehur razvio u pluća, kao prilagodba na sušna razdoblja. Dvodihalice inače dišu škrgama. Poznate su vrste: afrička, australska i južnoamerička dvodihalica. DVODOMNE BILJKE, v. cvijet. DVOIMENO NAZIVLJE, v. binomna nomenklatura. DVOJNA DIOBA, oblik nespolnog razmnožavanja u kojem se matična jedinka dijeli na dva dijela pri čemu ona sama nestaje kao jedinka. Dvojnom diobom se razmnožavaju uglavnom jednostanični organizmi: neke jednostanične alge, neke vrste bakterija i mnoge praživotinje. DVOJNO NAZIVLJE, v. binomna nomenklatura. DVOSPOLAC (hermafrodit), kod životinja organizam koji ima i muške i ženske spolne žlijezde (sjemenike i jajnike) u kojima se proizvode spermiji i jaja. Česta pojava kod bezkralježnjaka, npr. spužve, plošnjaka, nekih puževa i kolutićavaca. DVOSTRUKA DIOBA, v. dvojna dioba. DVOSTRUKA MEMBRANA, građena od vanjske i unutarnje membrane, a imaju je jezgra, mitohondriji i plastidi. DVOSTRUKI BROJ KROMOSOMA, v. diploidni broj kromosoma. DVOSTRUKI KROMOSOMI, građeni su od dvije kromatide. DVOSUPNICE, razred kritosjemenjača. Najčešće porodice i njihovi predstavnici: žabnjaci, ruže, bukve, breze i lijeske, krstašice, lepirnjače, štitarke, usnače i glavočike.

Osobine dvosupnica Dvije supke u sjemenci; Embrio centralno (u sredini) smješten u sjemenci; Žile u stabljici smještene u krugu; Žile otvorene, tj. s kambijem; Imaju sekundarni rast u debljinu; Nervatura lista perasta ili dlanasta, među ograncima žila međusobno mrežasto povezane žilice; Ocvijeće razlučeno u čašku i vijenčić; Ocvijeće i prašnici većinom s 4 ili 5 članova u krugu.

E
EGZOCITOZA, proces u kojem se čestice izbacuju iz stanice u međustanični prostor, tj. oblik masovnog transporta tvari kroz membranu stanice pomoću membranskih mjehurića koji se stapaju sa staničnom membranom. Suprotan proces je endocitoza. EGZOKONJUGANTI, v. konjugacija. EGZOSKELET, v. kostur. EHINOKOK, v. pasja trakavica. EIGEN, M. postavio genetičku hipotezu o izgledu i funkcioniranju prvih organizama (praorganizama) na Zemlji. EJAKULACIJA, refleksno izbacivanje sperme za vrijeme muškarčeva orgazma. EKOFIZIOLOGIJA, znanost koja proučava djelovanje različitih ekoloških čimbenika na funkciju stanica, tkiva, organa i organskih sustava. EKOLOGIJA (grč. oikos = dom, stanište, logos = riječ, govor), znanost koja proučava odnose živih bića i okoliša; znanost o

35

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

proizvodnji i raspodjeli organske tvari u prirodi te o gustoći naselja biljnih i životinjskih vrsta. EKOLOŠKA NIŠA, obilježava mjesto i ulogu jedne vrste u životnoj zajednici. Niša nekog živog organizma određena je čimbenicima kao što su stanište, hrana i temperatura. Iako dvije vrste mogu dijeliti isto stanište, one nikada ne dijele istu nišu. EKOLOŠKA VALENCIJA, je razmak između donje i gornje granice vrijednosti nekog ekološkog čimbenika (temperatura, svjetlo, voda itd) u okviru kojega je moguć život organizma; različita je za svaki čimbenik i za svaku vrstu, v. ekološki maksimum, ekološki optimum i ekološki minimum. EKOLOŠKI ČIMBENICI, v. abiotički čimbenici i biotički čimbenici. EKOLOŠKI MAKSIMUM, najveći intenzitet nekog čimbenika koji može neki organizam podnijeti, v. ekološka valencija. EKOLOŠKI MINIMUM, najmanji intenzitet nekog čimbenika koji mora postojati da organizam živi, v. ekološka valencija. Poznato je Liebigovo pravilo ekološkog minimuma koje upozorava da je ograničavajući čimbenik onaj koji je najmanje zastupljen u staništu, tj. ona tvar kojom organizam najmanje raspolaže. EKOLOŠKI OPTIMUM, optimalna vrijednost djelovanja nekog čimbenika na organizam, v. ekološka valencija. EKOSUSTAV, sustav bioloških, kemijskih i fizičkih zbivanja koji obuhvaća biotop i biocenozu. Produktivnost ekosustava izražava se proizvodnjom organskog ugljika. Od kopnenih ekosustava najproduktivnija je šuma, a od slatkovodnih jezero s tvrdom vodom.

EKOTIP, nasljedno izmijenjen oblik neke biljke ili životinje uslijed prilagodbe na specifičnost okoliša, npr. poljski miš. EKOTOKSIKOLOGIJA, znanost koja proučava posredni ili neposredni učinak stranih tvari (ksenobiotika) na prirodu, na sve živuće organizme i njihovu organizaciju, odnos prema neživoj tvari, međuodnose i odnos prema čovjeku. EKSKRECIJA, izlučivanje (bubrezima ili kroz kožu) nekorisnih i štetnih tvari. EKSPERIMENT (pokus), promatranje pojave koja se ispituje po točno određenim uvjetima koji dozvoljavaju da se prati tijek pojave te da se ona svaki put uz ponavljanje istih uvjeta ponovo izazove. EKSTRACELULARNA (izvanstanična) PROBAVA, hranjive se tvari probavljaju u probavnoj šupljini mnogostaničnih životinja. Npr. to je gastrovaskularna šupljina kod žarnjaka, isp. EKTODERM, vanjski zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka živčani sustav i osjetila, epitelno tkivo i njegovi derivati. EKTOPLAZMA, vanjski, periferni dio protoplazme. ELEKTRIČNI POTENCIJAL, nastaje na razini receptora direktnim podraživanjem, odnosno na razini sinapse podraživanjem idućeg neurona neurohormonima. Stanica se depolarizira kada u nju difundiraju ioni natrija kroz otvorene ionske kanale. Potencijal stanice se sa –90 mV promijeni na +50 mV. Promijenjeni električni potencijal receptora prenosi se dalje dendritom u tijelo neurona, a odatle aksonom do završnih nožica. Ubrzo nakon depolarizacije nastupa brza repolarizacija tj. stanica se vraća sa +50 mV ponovno na –90 mV. Repolarizacija stanice ostvaruje se izbacivanjem kalija i natrija iz stanice u

36

selen. snimanje moždanih valova. a razvijaju se tijekom embrionalnog razvitka razvijenijih životinja i čovjeka. a iz njih daljnjim razvojem pojedini organi i organski sustavi. v. embryon = zametak. a bilježe se elektrokardiografom. Iz njega će se gastrulacijom razviti zametni listići. to su fosfor. magnezij. tromboza. klica. grafički prikaz moždanih valova. krivulja električnih potencijala srčanog mišića. QRS . znanost o razvoju živih bića iz oplođene jajne stanice.kompleks koji pokazuje mjerenje depolarizacije klijetki i repolarizacije pretklijetki. EMBRIONALNI RAZVITAK. željezo. sumpor. ELEKTROENCEFALOGRAFIJA (EEG). vodika oko 10 %. Dodatak 3. vodik. neurohormoni. Embrionalne ovojnice u čovjeka su: korion. U ljudskom tijelu više je od 70 kemijskih elemenata. Na/K pumpe. te T-vala koji pokazuje rezultat mjerenja klijetki za vrijeme njihove repolarizacije. ELEKTRONSKI MIKROSKOP.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE okolinu uz utrošak energije procesom tzv. v. mangan i aluminij. ELEKTROENCEFALOGRAM (EEG). amnion (vodenjak). Postupak je značajan za otkrivanje živčanih i duševnih bolesti. radij itd. kalcij. Normalan EKG sastoji se od: P-vala. Mikroelementi izgrađuju preostalih 1 %. Daljnjim diobama tih stanica razvija se embrio (klica). zatim ugljika oko 20 %. Kod biljaka započinje inekvalnom (asimetričnom) diobom zigote kojom nastaju bazalna i vršna stanica. alantois i placenta (posteljica). rutenij. ugljik. EMBRIJ (zametak). endoderm i mezoderm. Makroelementi izgrađuju oko 99 % težine našeg tijela. genesis = postanak. Pločaste elektrode. Tijelo dobiva 37 . skupina embrionalnih stanica sisavaca koja se nalazi u unutarnjosti blastociste. proces diferencijacije stanica u različita tkiva i organe. Najviše je kisika i to oko 60 %. v. Stadiji embrionalnog razvitka su najprije brazdanje i gastrulacija. koji pokazuje mjerenje depolarizacije pretklijetki. životinjski i čovječji organizam u ranim stadijima razvitka nakon oplodnje. isp. embrijem se naziva organizam star do dva mjeseca trudnoće. EMBRIOLOGIJA. a zatim organogeneza i histogeneza. koje se postave na određena mjesta na glavi. EMFIZEM PLUĆA. dušik i kalij. to su kisik. posebne strukture koje imaju važnu ulogu u zaštiti i prehrani zametka. endoplazmatska mrežica. EMBRIOBLAST. U čovjeka. EMBRIO. to su npr. dušika oko 4 % i različitih minerala oko 6 %. titan. bilježe moždanu (električnu) aktivnost kore velikog mozga. klica. klor. mikroskop. EMBOLUS. ektoderm. ELEKTRO-KARDIOGRAM (EKG). v. v. razvitak). EMBRIOGENEZA (grč. jer se s aktivnošću mijenja i ukupna količina električnih potencijala podraženih neurona. Mijenja se ovisno o aktivnosti pojedinih područja mozga. natrij. ELEMENTI. bolest dišnog sustava u kojoj dolazi do oštećenja i smanjenja broja alveola u plućima. cink. ELEMENTARNI SASTAV govori od kojih se kemijskih elemenata sastoji nešto. Ultramikroelemenata ili oligoelemenata ima samo u tragovima. EMBRIONALNE OVOJNICE. biljni. žumanjčana vreća. razvoj zametaka većine životinjskih organizama. EM.

središnji. hranjivo staničje koje služi prehrani klice (embrija) prilikom klijanja sjemenke. ENDOPLAZMATSKI RETIKULUM. način zajedničkog života kada jedan organizam živi u drugome. biljna i životinjska vrsta koja je rasprostranjena samo na nekom užem području ili arealu. a luče hormon testosteron. ENDODERMA. ENDOKRINE ŽLIJEZDE (žlijezde s unutarnjim izlučivanjem). organski spojevi (proteini. žlijezde koje svoje produkte (hormone) izlučuju u krv. Brusnik. polipeptidi) koji upravljaju kemijskim reakcijama organizma kvalitativno i kvantitativno. U toj zajednici oba organizma imaju korist. ENZIMI (fermenti. sloj stanica koji odvaja vanjski dio korijena od provodnih elemenata ksilema u središnjem cilindru korijena. Tada alge koriste neke produkte metabolizma bičaša. ENDOCITOZA. Neki naši otoci (npr. steroidni hormoni. unutarnji dio protoplazme. su specijalizirane stanice sjemenika koje leže između sjemenih kanalića. U brojnim vrstama bezbojnih bičaša žive modrozelene alge koje obavljaju ulogu kloroplasta (fotosinteza). sinteza inzulina. ENDOPLAZMA. Stanice endoderme aktivno izlučuju vodu i tvari u provodne žile i tako se stvara korijenov tlak. unutarnji zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka probavilo i probavne žlijezde. sustav kanalića omeđenih membranom koji prožima citoplazmu eukariotskih stanica. npr. ENDEM. ENERGIDA. ENDOPLAZMATSKA MREŽICA (endoplazmatski retikulum. Nastaje spajanjem spermalne stanice sa sekundarnom jezgrom embrionske vreće. Kada hrana uđe u stanicu ili tijelo npr. nadbubrežne žlijezde. Iz podzemlja našeg krša poznati su endemi vodozemac čovječja ribica i pijavica iz Lukine jame na Velebitu. tvorevina koja se sastoji od jezgre i pripadajuće citoplazme kojom ta jezgra upravlja. Obzirom na veličinu čestica tvari razlikujemo unošenje sitnih čestica. Hrapava EM ima važnu ulogu u sintezi proteina. v. Jabuka i Palagruža) imaju endemične vrste gušterica. npr. praživotinje.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ sve manje kisika. biokatalizatori). štitna žlijezda. a bičaši produkte fotosinteze. ENDOSPERM. sinteza antitjela itd. spolne žlijezde (sjemenici i jajnici) te gušterača koja ima osim endokrine i egzokrinu ulogu. fagocitozu. unošenje tvari u stanicu uvrtanjem stanične membrane oko njih. ENDOSKELET. ENDODERM. endoplazmatska mrežica. prsna žlijezda (timus). izlučivanje probavnih enzima u početni dio tankog crijeva. Česti su endemi na udaljenim otocima. Endokrine žlijezde u čovjeka su hipofiza. pinocitozu i unošenje krupnih čestica. stvori se hranidbeni mjehurić ili probavna vakuola koja se spoji s lizosomima. v. ENDOKRINE INTERSTICIJSKE STANICE (Leydigove stanice). ENDOSIMBIOZA. Omogućuje transport tvari između stanice i okoliša te povezuje staničnu membranu s ovojnicom jezgre. a CO2 zaostaje u tijelu (plave usne). Glatka EM se nadovezuje na hrapavu i u njoj nastaju proizvodi neproteinske prirode. nuzštitne žlijezde. a pri tom 38 . kostur. a bez ribosoma glatka. u pećinama i sl. ER). EM. škrge te drugi unutarnji organi. EM koja sadrži ribosome je hrapava. pluća. epifiza.

Izlučuje melatonin. npr. Po kemijskom sastavu su steroidi kao i ostali spolni hormoni. Utječu 39 . Jedno je autonomno središte. pokožica. EPITELNO TKIVO (pokrovno tkivo). ražova gljivica. EPIDERMA.8⋅1012. najbrojnije krvne stanice (u litri krvi muškaraca ih ima oko 4. EPIFIZA. mnogi lišaji. EPIDIDYMIS. a u žena 3. ESCHERICHIA COLI (ešerihija). ali ne kao nametnik. v. Prosječan životni vijek zdravog eritrocita u krvi je oko 4 mjeseca nakon čega se razgrađuju najvećim dijelom u slezeni.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE se sami ne mijenjaju. koža. Izlučuju ga bubrezi pri smanjenoj koncentraciji kisika u organizmu što se npr. a drugo je pod nadzorom središta u mozgu. endoplazmatska mrežica. biljka koja živi na drugoj biljci. ERITROPOETIN. Za djelovanje većine enzima napovoljniji pH je 7. Ulaskom u krv izaziva sepsu. Isp. v. mladojj stabljici). Zreli eritrociti su jedine žive stanice u čovjeka koje nemaju jezgru. EPIFIT (grč. naglo proširenje neke zarazne bolesti u nekom kraju pri čemu u ograničenom vremenu oboli veći broj stanovnika. Odatle smeđa boja stolice i žuta boja mokraće. EROZIJA.4 do 5. isp.8 do 4. za proizvodnju inzulina. Razgradnjom hemoglobina nastaje žuti pigment bilirubin koji se izlučuje iz krvi i iz jetre putem žuči u crijevo gdje se uz pomoć bakterijskih enzima pretvara u smeđi sterkobilin B i žuti urobilin B. pasjemenik. pokrovno tkivo na nježnim dijelovima biljke (listu. hormon koji stimulira razvoj i sazrijevanje eritrocita u koštanoj moždini. v.9⋅1012. Temeljna im je uloga prijenos kisika i ugljikovog dioksida između plućnih alveola i tkiva. Koristi se u genetičkom inženjerstvu. Erekciju nadziru dva erekcijska središta u leđnoj moždini. hormon koji sudjeluje u pigmentaciji. ESTROGENI. Razlikujemo fetalni (HbF) i adultni (HbA) hemoglobin koji se međusobno razlikuju po sastavu polipeptidnih lanaca globina što za posljedicu ima da fetalni hemoglobin ima veću sposobnost vezivanja kisika kod nižih koncentracija kisika od adultnog hemoglobina. Najvažniji im je sastojak hemoglobin koji se sintetizira u koštanoj srži u stanicama prethodnicama eritrocita koje još imaju jezgru.epi = na. ali može uzrokovati infekcije mokraćnog sustava i proljeve u male djece. Najčešće su epidemije uzrokovane bakterijama i virusima. EOZINOFILNI leukociti LEUKOCITI. vremensko razdoblje od milijardu godina. npr. razaračko djelovanje voda na tlo. žlijezda s unutarnjim izlučivanjem smještena sa stražnje strane između velikog i malog mozga. ženski spolni hormoni koje luče jajnici. pokriva tijelo i unutarnje organe životinja. ER. luči potrebne sekrete iz žljezdanih epitelnih stanica. ERITROCITI (crvene krvne stanice). EPIFIZA. EPIDEMIJA. javlja kao posljedica smanjene koncentracije kisika u atmosferi na velikim visinama. v. bakterija iz sastava crijevne flore čovjeka. kod muškaraca nabreknuće i ukrućenje spolnog uda. phyton = biljka). kost. kožno staničje. EON. tropske orhideje i paprati u krošnji tropskih šuma. v. ERGOT. Odgovara epidermi biljaka. EREKCIJA. pousmina. meningitis i druga oboljenja. kod. krvna tjelešca.

npr. Stanice eukariota dijele se mitozom. a to su sve životinje i biljke osim bakterija i modrozelenih algi (cijanobakterija). jezgrice. EUTROFIZACIJA (eutrofikacija). v. ribosome. kromosome. Također su odgovorni za normalan tijek trudnoće i poroda. svi jednostanični ili višestanični organizmi čije je tijelo građeno od eukariotskih stanica. Escherichia coli. Produkt fotosinteze je polisaharid paramilum. endoplazmatska mrežica. krayon = jezgra) ili euciti. Utječu i na formiranje niza sekundarnih spolnih značajki. lizosomi. stanice koje sadrže jezgru obavijenu membranom i u citoplazmi ostale stanične organele obavijene membranom. eutrofizacija. EUCITI. EVOLUCIJA (biološka evolucija). eu = pravi. Tako 28. eukariotske stanice. EUKARIOTI. vakuole. razvoj dojki. Eukariotske stanice su veće i složenije od prokariotskih stanica i imaju sposobnost izgradnje višestaničnog organizma. v. EŠERIHIJA.) stanična stijenka sadrži celulozu EUTROFIKACIJA. kloroplaste itd. Stimulira sazrijevanje plodova.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ na rast i razvoj ženskih spolnih organa kao primarnih spolnih značajki. Neki eukarioti imaju i bičeve za pokretanje. jedini plinoviti biljni hormon. v. centriole (kod životinja) koji nisu obavijeni membranom te ih ne smatramo organelima u užem smislu. povećanje primarne organske proizvodnje u vodenim ekosustavima nakon obogaćivanja vode hranjivim tvarima koje potiču razvoj alga i višeg vodenog bilja. raspored dlaka i drugo. npr. nego nukleoid jedan kromosom dioba cjepanjem nema staničnih organela stanična stijenka sadrži murein Eukariotska ima potpuno oblikovanu jezgru više kromosoma dioba mitozom ima stanične organele (mitohondrije. crvenu očnu pjegu i kontraktilnu vakuolu (tipično za životinje). Zato se euglena može smatrati biljkom. ETILEN. centrosom. Stanični organeli eukariotskih stanica su jezgra. ali pokatkad i životinjom. EUGLENA (Euglena viridis). Najvažnije razlike stanica Prokariotska nema oblikovanu jezgru. Ima plastide. Golgijevo tijelo i plastidi (kod biljaka). Eukariotske stanice sadr- že i manje stanične strukture. rast i razvoj kostiju. dana smanjena količina estrogena uzrokuje ljuštenje odebljale sluznice maternice. bičaš vretenastog tijela bez čvrste stijenke. inhibira rast te potiče otpadanje listova i proces starenja. postupni povijesni razvoj najjednostavnijih oblika živog svijeta k sve složenijim. EUKARIOTSKE STANICE (grč. Postoje dva oblika eutrofizacije: prirodni i antropogeni (uzrokovan djelovanjem čovjeka). odlaganje masnih tvari u potkožnom sloju. Stvara se u većini biljnih organa. kloroplaste. 40 . euglena uzima organsku hranu. Biološkoj evoluciji je prethodila kemijska evolucija odnosno postanak i razvoj organskih spojeva na Zemlji. savršenijim i raznolikijim oblicima na Zemlji. Reguliraju zbivanja u menstrualnom ciklusu. Grana biologije koja proučava taj razvoj zove se znanost o evoluciji. Kada nema svjetla. mitohondriji.

FIBRINOGEN. npr. heterozigoti) mogu imati jednak fenotip.majku. bolest koja se pojavljuje u trudnoći u djece koja su Rh+. oblik endocitoze. Prema konačnim produktima vrenja razlikujemo: alkoholno. selidba životinja i dr. FENOTIP. proces u kojem se anaerobno (bez prisutnosti kisika) razgrađuju organski spojevi pri čemu se oslobađa dio energije. stvara se veća količina antiRh aglutinina pa se u djeteta pojavljuju simptomi bolesti. vrijeme listanja. Posljedica hemolize eritrocita je anemija (slabokrvnost). v. bjelančevina u krvi koja je jedan od sudionika u zgrušavanju krvi. isp. mliječno i octeno. stanice sa sposobnošću fagocitoze (isp. periodičke sezonske promjene organizama. fagein = jesti. a imaju Rh. skup svih životinjskih vrsta nekog određenog područja. kada ista Rh. gutati. a osim toga u djeteta se javlja i žutilo kože jer se hemoglobin iz raspadnutih eritrocita pretvara u žučne boje koje su žute. proces kojim neki prokarionti prevode atmosferski dušik u amonijeve ili nitratne spojeve iskoristive za biljku. dominantni su za oba svojstva. FENOLOŠKE POJAVE. uz pomoć lizosoma. Produkti vrenja su obično alkoholi i organske kiseline. Koštana srž djeteta nastoji nadoknaditi razorene eritrocite pa intenzivno stvara i u krv otpušta nezrele eritrocite (eritroblaste) koji po funkciji ne mogu u potpunosti zamijeniti eritrocite. FERMENTACIJA (vrenje). enzimi. FETUS (plod). FENILALANIN. razgrađuju mikroorganizme i čestice sličnih veličina. FETALNI HEMOGLOBIN. FAZNI MIKROSKOP. organizmi različitih genotipova (homozigoti.) u koje spadaju neutrofilni leukociti. AaBb imaju isti fenotip. Vrenja uzrokuju različiti mikroorganizmi (bakterije. monociti i tkivni makrofagi. Također i način uzimanja hrane u praživotinja. v. dipeptid. zametak čovjeka starosti od dva mjeseca pa do rođenja. AaBB. FAUNA. shvaćanje da su vrste nepromijenjive. genetički izraz kojim se označava zbroj morfoloških i fizioloških svojstava nekog organizma.majka nosi ponovo Rh+ dijete. ali i o djelovanju okoliša. FETALNA ERITROBLASTOZA. A i B. kytos = šupljina). FAGOCITOZA (grč. v. eritrociti. npr. kemijski spoj nastao vezivanjem dviju aminokiselina: fenilalanina i serina. FENILALANILSERIN. gljvice) i na taj način dolaze do energije koja je potrebna za njihove životne aktivnosti. U nasljeđivanju dominantnih i recesivnih svojstava. pri svakoj narednoj trudnoći. padanja lišća u bilja. npr. neutrofilni leukociti. kod dihibridnog križanja s dominacijom jedinke različitih genotipova: AABB. Međutim. AABb. FIKSIZAM. dušikove bakterije.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE F FAGOCITI. cvatnje. Tako. (hemolitička bolest novorođenčadi). 41 . FIKSACIJA DUŠIKA. Tijekom prve trudnoće u djeteta nema znakova fetalne eritroblastoze jer se u krvi majke nije stvorila veća količina anti-Rh aglutinina koji bi uzrokovali razaranje (hemolizu) djetetovih eritrocita. a dio ostaje u produktima. On je ovisan o nasljednim faktorima ili genima (genotipu). sposobnost stanica. neutrofila da proždiru i. mikroskop. v. tj. FERMENTI. FAGOSOMI. v. kemijski spoj iz skupine aminokiselina.

FITOPLANKTON. vrsta. stanica. v. koine = zajednica). fitocenoza. To su pigmenti koji maksimalno apsorbiraju u crvenom i tamnocrvenom dijelu spektra. koljeno. Npr. sukcesivna evolucija. znanstveno područje biologije koje se bavi proučavanjem podrijetla organizama na Zemlji i njihovim razvrstavanjem u rodoslovno stablo. prašnik. FITOCENOZA (grč. FIZIOLOŠKA HIPOTEZA. znanost o biljnim zajednicama. (rodbinsko sustavoslovlje). FILOKADIJE. Daljnje temeljne jedinice su red i razred. Postoje različite fiziološke otopine. v. Ovu biljnu komponentu biocenoze proučava znanost fitocenologija. razvrstavanje živih bića u filogenetski (prirodni) sustav. a obuhvaća usko srodne organizme. po sastavu su bjelančevine. FILOGENIJA (grč. v. fylon = pleme. otrovni kojima se uništavaju nepoželjne biljke.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ FILAMENT. Temeljna sustavska jedinica je vrsta. npr. fyton = biljka. prirodna biljna zajednica u kojoj zajedno žive određene biljke na određenom staništu. Što je dan dulji stvara se više aktivnog fitokroma pod utjecajem bijele i crvene svjetlosti. FILOGENETSKI NIZOVI. Prema toj hipotezi praorganizam je mogao izgledati poput nekog složenijeg koacervata koji je imao sposobnost jednostavne izmjene tvari i samoobnavljanja. Unutar sustava živa bića se svrstavaju u sustavske (sistematske) jedinice. FILETIČKA EVOLUCIJA. a koljeno kada se radi o životinjama. drugi naziv za biljojede. FITOCENOLOGIJA. v. FILOGENETSKI (prirodni) SUSTAV ukazuje na srodstvene odnose između pojedinih razvojnih skupina živih bića i unutar njih. fitocenoza. tj. biljna stanica. posebna otopina različitih soli i glukoze. FILOGENETSKA SISTEMATIKA. razvojni nizovi. plankton. Oparin. FITOCID. hipoteza čiji je zastupnik ruski biokemičar A. a obuhvaća srodne vrste. Isp. v. Osim temeljnih sustavskih jedinica neki autori rabe i druge. prošireni dijelovi stabljike u obliku listova koji preuzimaju ulogu fotosinteze. FIZIOLOGIJA. fiziološka otopina NaCl koja 42 . genesis = postanak). taksonomija. FITOCENOLOGIJA. specifični biljni fotoreceptori. znanost koja proučava životne procese živih bića. preobraženi. Još složeniji je odjeljak/koljeno te najsloženija temeljna sustavska jedinica carstvo. ali u osnovi su to izotonične otopine koje imaju sastav sličan sastavu tjelesnih tekućina pojedinog organizma. FITOCELULA. Prva složenija sustavska jedinica je rod. FIZIOLOŠKA OTOPINA. Potiču brojne reakcije biljaka na svjetlost. Nalaze se u plazmi stanica listova u vrlo malim količinama. Koacervati su koloidne kapljice s opnama. nadcarstvo itd. rod. FITOKROMI. Odjeljak i koljeno su jednake složenosti s tim da se naziv odjeljak uobičajeno rabi kada se govori o biljkama. J. potkoljeno. FITOFAGI. a nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli. a tumači postanak prvih organizama (praorganizama) na Zemlji. isp. Srodni rodovi obuhvaćeni su jednom porodicom. takve organizme koji se međusobno mogu spolno razmnožavati. Fitokrom postoji u aktivnom i inaktivnom obliku. v.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE se koristi za infuziju sadrži 0. FLORIGEN. FOTOBIOLOŠKO PODRUČJE. isp. fitokromima. FLEMING. nukleinske kiseline i ATP. v. FLORISTIKA . FOSFATNA KISELINA (fosforna kiselina). prijelazni oblici. lat. FLORA. Imaju važnu strukturnu ulogu u stanici jer se nalaze u sastavu svih membrana stanice. FOTOPERIOD (relativna duljina dana i noći). Homo sapiens. Fosili nastaju: okamenjivanjem. npr. FLOEM. flora nekog otoka.). planine. fototaksije i fotomorfogeneze (promjene oblika djelovanjem svjetlosti). Kontrolirane su specifičnim fotoreceptorima. države i sl. Građeni su od trovalentnog alkohola glicerola na kojem su esterski vezane dvije više masne kiseline. a preko treće OH skupine vezana je fosfatna kiselina. FOSILNI ČOVJEK. proces nastajanja fosila. promjena oblika kod biljaka koje se događaju pod utjecajem svjetlosti. FLUID. FOSFORNA KISELINA. FOTOMORFOGENEZA. FOLIKUL STIMULIRAJUĆI HORMON. pougljenjivanjem ili konzerviranjem. dio spektra Sunčevog zračenja. (1881. mikroskop. hormon cvjetanja. Osim fotosinteze. britanski mikrobiolog. Njeni kiselinski ostaci izgrađuju izuzetno važne spojeve. FOSFOLIPIDI. prvi antibiotik. a u drvenastih biljaka redovito se nalazi u kori. npr. god.9 % NaCl (0. 1929. isp. v. FOSILNI PRIJELAZNI OBLICI. unutarnja želja ili potreba za promjenom određenih karakteristika (po Lamarcku). v. v. znanost o flori. fosfatna kiselina. fotoperiodizam. vrsta provodnog tkiva u biljaka koja služi za provođenje asimilata (produkata fotosinteze) od listova prema ostalim dijelovima biljke. v. ostaci biljnih i životinjskih organizama iz davnih razdoblja Zemljine prošlosti. v. Floem je građen od sitastih cijevi i stanica pratilica. Preko fosfatne skupine vezan je obično neki aminoalkohol. FOSILIZACIJA. skup svih biljnih vrsta nekog određenog područja. nastije. O HO P OH OH 43 . Eritrociti u takvoj otopini ostaju neoštećeni. provodno staničje. A. otkrio penicilin. svjetlost valnih duljina koje odgovaraju vidljivom dijelu spektra (380-760 nm). Isp. Važan su paleontološki dokaz evolucije. organski spojevi iz grupe lipida koji sadrže fosfatnu skupinu (ostatak fosfatne kiseline). kemijski spoj empirijske formule H3PO4. v. FOTONASTIJA. glavni okolišni čimbenik pomoću kojeg biljke određuju godišnje doba.15 mola po litri otopine) te je izotonična (iste koncentracije) prema eritrocitima. FLUORESCENIJSKI MIKROSKOP. Struktura florigena još nije poznata. valne duljine ovog dijela spektra uzrokuju i fototropizme. FSH. Sintetizira se u listovima u povoljnim uvjetima i prenosi se u vegetacijske vrškove gdje potiče cvjetanje. FOSILI (okamine. fossus = iskopan). – 1955.

Shema fotosinteze 44 . S. Obično se zbiva za toplih. Sastoji se od antenskog kompleksa. štapići i čunjići. FOX. Fotosintezu možemo predočiti jednadžbom: 6CO2 + 12H2O + svjetlosna energija → → C6H12O6 + 6O2 + H2O Fotosinteza se sastoji od dva stadija: 1. vidne stanice. proces koji se odvija u kloroplastima biljnih stanica u kojem biljka iz anorganskh spojeva (vode i CO2) izgrađuje ugljikohidrate i druge organske spojeve koristeći svjetlosnu energiju Sunca. Korijen pokazuje negativni fototropizam jer raste u suprotnom smjeru od izvora svjetlosti. FOTORECEPTORI. američki znanstvenik koji je u svojim pokusima dobio mikrosfere. taksija. otpušta CO2 i ne nastaje ATP. početak cvjetanja. savijanje organa prema izvoru svjetlosti (pozitivni fototropizam). v. mrežnica. v. FOTOSINTETSKA FOSFORILACIJA proces sinteze ATP-a uz pomoć svjetlosne energije Sunca koji se odvija za vrijeme transporta elektrona u kloroplastima. metabolički put kojim se smanjuje učinak fotosinteze: troši se kisik. reakcijskog središta klorofila a i primarnog akceptora elektrona. Pojavu uzrokuje auksin (hormon rasta) koji djelovanjem svjetlosti prelazi u zasjenjenu stranu klice ili stabljike gdje uzrokuje pojačan rast. FOTOTAKSIJE. pravilna izmjena dana i noći. reakcije u tami (sekundarne reakcije ili Calvinov ciklus) koje se zbivaju u stromi kloroplasta u kojima se reducira ugljikov dioksid i sintetiziraju ugljikohidrati. okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama čime je pridonio razumijevaju razvoja živog svijeta na Zemlji. otpadanje listova u jesen). vedrih i suhih dana kada su puči zatvorene a koncentracija kisika u listu viša od koncentracije CO2. gibanje biljke rastom tj. FOTOSISTEM. svjetlosne (primarne) reakcije koje se zbivaju u tilakoidnim membranama kloroplasta u kojima se Sunčeva energija pretvara u kemijsku energiju (ATP i NADPH) i oslobađa kisik i 2. Biljke reagiraju različitim fiziološkim procesima na duljinu dana tj trajanje dnevnog svjetla (npr. fotosintetska jedinica koja je smještena u tilakoidnoj membrani kloroplasta.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ FOTOPERIODIZAM. FOTOSINTEZA (asimilacija CO2). FOTOTROPIZAM. FOTORESPIRACIJA.

druga etapa embrionalnog razvitka mnogih višestaničnih životinja u kojoj dolazi do gibanja embrional- G G0. pušenjem. GASTRIN. a muške gamete su spermiji koji nastaju u sjemenicima (testisi). FUNGICID. Gastrin potiče i glavne stanice želučanih žlijezda da luče pepsinogen. Isp. jaka mučnina. GAMETANGIOGAMIJA. zajednički naziv za spermatogenezu i oogenezu. GASTROENTERITIS (pokvareni želudac. a u muškarca spermatogenezu. GASTRITIS.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE FREON. biocid. najčešće uzrokovana agresivnim djelovanjem žestokih alkoholnih pića. organski spoj. hormon stimulacije folikula). U žene stimulira rast folikula jajnika. katkad i povraćanje.FAZA. Najčešći je uzročnik virus koji se lako prenosi dodirom. spolne rasplodne stanice. GASTRULA. GARIG. interfaza. Najslađi je od svih šećera. npr. hormon iz skupine gonadotropnih hormona koje luči prednji režanj hipofize (adenohipofiza). konzumiranjem jako začinjene hrane ili djelovanjem nekih lijekova (npr. spolna generacija u biljaka koja sadrži muške i ženske rasplodne organe. v. Luče ga želučane žljezdane stanice podražene hranom u želucu. v. upala želučane sluznice. FRUKTOZA (voćni šećer). G2.FAZA. interfaza. Gastritis prate napadaji boli želuca. FSH (folikul stimulirajući hormon. U čovjeka ženska gameta je jajna stanica koja nastaje u jajnicima (ovariji). 45 . GAMETOGENEZA. v. stvaranje muških i ženskih spolnih stanica (gameta). sintetizirani spoj iz skupine spojeva klorfluorugljika koji se rabi kao potisni plin. crijevna gripa) je opći naziv za manju infekciju želuca i tankoga crijeva praćenu mučninom. nakupina živčanih stanica. jednostavni šećer ili monosaharid. bolovima (grčevima) u trbuhu. GASTRULACIJA. v. povraćanjem i/ili proljevom što obično traje 1 do 2 dana. interfaza. v. zajednica niskog bilja koje nastaje sječom vazdazelene šikare. Dolazi u voću. a uništava ozonsku ovojnicu. gastrulacija. Fruktoza se u organizmu lako prevodi u glukozu. spajanje cijelih spolnih organa prilikom razmnožavanja. a ne samo hranom ili pićem. GAMETE. Njezina empirijska formula ista je kao i formula monosaharida glukoze i galaktoze (C6H12O6) iz skupine aldoheksoza (šećera sa šest atoma ugljika i aldehidnom funkcionalnom skupinom) dok ona spada u ketoheksoze (šećere sa šest atoma ugljika i keto funkcionalnom skupinom). G1-FAZA. Tijekom evolucije biljnog svijeta došlo je do redukcije gametofita u odnosu na nespolnu generaciju (sporofit). probavni hormon. GANGLIJ. Apsorbira se u krv i krvlju se prenosi do obložnih stanica. acetilsalicilna kiselina). haploidna generacija. GAMETOFIT. Odvija se u spolnim žlijezdama muškaraca (sjemenici) i žena (jajnici) pod djelovanjem istih gonadotropnih hormona: FSH i LH. medu i kao sastavni dio nekih složenih šećera ili oligosaharida. saharoze.

histidin C . gen CB. organi koji služe isljučivo za razmnožavanje.lizin Phe . više gena mogu biti odgovorni za samo jedno svojstvo. Jedan gen ne mora uvijek biti odgovoran samo za jedno svojstvo nego može biti odgovoran i za više njih. Vrijedi i obrnuto. U žena se sljepoća za boje pojavljuje samo ako se tako promijenjeni geni nalaze u oba x-kromosoma.stanje. GEN.leucin kiselina Ile . v. daltonizam). GENETIČKA UPUTA (genetička šifra).aspargin G . sljepoća za boje.adenin Asn . dio molekule DNA koji djeluje kao određena funkcionalna jedinica.treonin Gly . Genetička uputa.tirozin U . GEN DALTONIZMA. U C A G Phe Ser Tyr Cys U Phe Ser Tyr Cys C Leu Ser stop stop A Leu Ser stop Trp G Leu Pro His Arg U Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G Ile Thr Asn Ser U Ile Thr Asn Ser C Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly G I.cistein Ser . gen CB.citozin Gln . GEMULA.metionin kiselina Val . informacija o rasporedu dušičnih baza u molekulama DNA. skrutnuti oblik koloidnih otopina. žene su normalnog vida ali su prijenosnici tog gena na potomstvo. gušći. v.arginin Thr . Tablica 1. mezoderm) i zovemo ga gastrula. gastrulacija u vodozemaca započinje gibanjem stanica blastoderma.izoleucin Glu . spužve. genetička uputa. GEN CB (CB = colour-blindness.gvanin Lys . GENERATIVNI ORGANI. v. materijalna osnova ili čimbenik nekog nasljednog svojstva.glicin Ala .prolin Arg .ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nih stanica u unutarnjost zametka.triptofan Pro .fenilalanin Asp . III. U C A G 46 .glutaminska Met . gen koji se nalazi u spolnom x-kromosomu.valin Cys . odnosno informacija o naravi pojedinih gena.) geni za ista svojstva nalaze se na homolognim kromosomima.asparginska Leu . npr. kodon. v. U daljnjem tijeku embrionalnog razvitka iz zametnih listića postupno će se diferencirati organi i tkiva (organogeneza i histogeneza). uputa. Oblik zametka koji nastaje kao rezultat gastrulacije sastoji se od tri zametna listića (ektoderm. GEN SLJEPOĆE ZA BOJE.serin Trp . crvenu od zelene.alanin Mjesto u kodonu II. Tako.uracil His . a u sisavaca gibanjem stanica embrioblasta. pri čemu nastaju zametni listići. GEL . Ako su muškarci nositelji takvog gena ne mogu razlikovati boje. npr. Kratice imaju značenje: Tyr . GENETIČKA ŠIFRA. slijed triju nukleotida u mRNA.glutamin A . endoderm. U diploidnim stanicama (isp. Ako se takav gen nalazi samo u jednom od x-kromosoma.

genetički izraz kojim se označuje ukupna materijalna osnova nasljeđa odnosno zbroj svih nasljednih faktora ili gena koji određuju nasljedna svojstva nekog organizma. citogenetske (citološke) karte kod kojih je raspored gena utvrđen genetičkim i citološkim istraživanjima.) i životinja (kunić. Svaki kodon odgovara pojedinoj aminokiselini (vidi tablicu 1. v. kokoš itd. GENSKA SNAGA. GENSKO STRUJANJE. Na primjer. Genetske karte su izrađene za mnoge vrste biljaka (ječam. H. GENOM. Pojam genetska karta potječe iz znanstvenog rada američkog genetičara T. U područje genetičkog inženjerstva ubrajamo i kloniranje. biljki ili pak čovjeka. uzimanje pojedinih stanica iz nekog organizma i stvaranje potpune kopije tog organizma te još neke druge slične metode. prijenos gena između populacija uz pomoć kretanja gameta. GENSKA SLUČAJNOST. šifra AUG znači ugradnju aminokiseline metionina u polipeptidni lanac i to je ujedno šifra za početak polipeptidnog lanca. a djelomice i za čovjeka. v. drift. haploidna garnitura kromosoma koja se nalazi u gametama.) te na taj način DNA preko mRNA određuje ugradnju pojedinih aminokiselina u specifičnu vrstu proteina. v. bakterija. postupci prenošenja određenih gena iz jedne vrste organizama u drugi. GEOTROPIZAM. tj. tropizmi 47 . genetička uputa. Genetičkim se inženjerstvom umjetno stvaraju hibridne molekule DNA kakvih do sada nije bilo u prirodi.). GEOLOŠKA DOBA. GENSKA UČESTALOST. GENETIČKE KARTE (kromosomske karte). jedinki ili skupine jedinki iz jedne populacije u drugu. relativni omjeri alela gena prisutnih u populaciji. drift. Genetičke šifre UAA. GENOTIP. taksija. GENOFOND. crossing-over genetske karte koje su izrađene samo na temelju postotaka izmjena dijelova homolognih kromosoma (crossing-overa) između određenih gena koji su vrlo blizu jedan drugoga. Morgana. kukuruz. v. Genetičke upute UUU i UUC znače ugradnju aminokiseline fenilalanina itd. Genetička uputa otkrivena je pokusima s genetičkim materijalom crijevne bakterije ešerihije (Escherichia coli). karte koje prikazuju smještaj i međusobnu udaljenost gena u kromosomima. GENETIČKO INŽENJERSTVO. GENETIČKI KOD. v. rajčica itd.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Tri nukleotida (dušične baze) koje nazivamo trojka ili triplet čine osnovu takve upute. GENETIKA (znanost o nasljeđivanju). Način označavanja genotipova prikazan je u primjerima monohibridnog i dihibridnog križanja s dominacijom. 2. GEOTAKSIJA. Postoje dvije vrste genetskih karti: 1. Važno je naglasiti da isti kodon (triplet) kodira istu aminokiselinu bez obzira da li se to događa kod virusa. znanost koja proučava pojave i uzroke međusobne sličnosti i nasljeđivanja svojstava u živih bića. dodatak 5. cjelokupni kompleks gena koji neka populacija sadržava u nekom vremenu. UAG i UGA znače kraj polipeptidnog lanca jer ne određuju ugradnju niti jedne od aminokiselina (nonsense code). a svaka trojka prepisana s DNA na mRNA naziva se kodon ili kod. v.

Zadržavaju sposobnost dijeljenja kroz cijeli život. Dolazi u sastavu unutarnjih organa. prekomjeran rast svih dijelova tijela zbog povećane razine hormona rasta u krvi koje luči hipofiza. muške su gamete još s bičevima. pripadaju skupini mekušaca. GINKO. GERMINATIVNI EPITEL (zametni epitel). najčešće s papusom kao prilagodba na rasprostranjivanje vjetrom. gorostasni kromosomi. medicinska struka koja se bavi liječenjem i sprečavanjem staračkih bolesti. Sjemeni su zameci. mreža potpornih i pomoćnih stanica živčanog tkiva koje se nalazi oko živčanih stanica. Obuhvaća zeljaste biljke s glavičastim cvatovima koji sliče velikim cvjetovima. npr. fizičkim i psihičkim svojstvima ostarjelih organizama te sociološkim problemima starijih ljudi. GLAVOČIKE. a oplodnja unutarnja. visoko i razgranato. GIGANTSKI KROMOSOMI. GLATKO MIŠIĆNO TKIVO. podbjel i pelin. skupina biljnih hormona koji stimuliraju rast stabljike i listova. GIBERELINI (giberelinske kiseline). Prirodno raste u istočnoj Aziji. vrsta mišićnog tkiva kojega izgrađuju stanice vre- tenastog oblika s jezgrom u sredini. dendrita i aksona. Spolovi su razdvojeni. GERONTOLOGIJA. Spermiji su nepokretni. mokraćnih i spolnih. Glavočike su najbrojnija porodica dvosupnica. skupina najrazvijenijih dvosupnica. Imaju trenicu. kemijski spoj iz skupine aminokiselina. a u žena u jajnicima. GLICIN. Svi su morski organizmi i grabežljivci: hobotnice. izoliraju živčana 48 . Navedene su biljke samo neke od oko 11000 poznatih vrsta. ljekovite su kamilica. Plod je roška. okruglasti i po dva na zajedničkom dršku. Često se sadi u gradovima jer dobro podnosi onečišćeni zrak. Sintetiziraju se u mladim listovima i korijenju te u embrijima. ima lepezaste listove s viličastom nervaturom. GIGANTIZAM. giberelini. Pokreću se izbacivanjem vode kroz lijevak. Uz probavilo imaju vrećicu s crnilom koje sadrži tamni pigment melanin. lignje i indijska lađica koja jedina ima vanjsku kućicu. U čahuri u glavi je "mozak" (nakupina svih živčanih ganglija). v. Svojim stezanjem omogućuje njihovu funkciju. GIBERELINSKE KISELINE. GLAVONOŠCI. Među glavočikama su mnoge biljke koje se uzgajaju kao povrće: salata i artičoka. stara i razvojno primitivna vrsta golosjemenjača. Cvjetovi su s cjevastim ili jezičastim vjenčićem. "živi fosil". Javlja se u razvojno doba. Stopalo je pretvoreno u krakove (8 ili 10) i lijevak koji vodi u plaštenu šupljinu u kojoj se nalaze škrge. U sjemenkama žitarica giberelini stimuliraju stvaranje enzima (α-amilaze) koji razgrađuju pričuvni škrob. GLIJA-STANICE. znanost o biološkim procesima starenja. a u žena jajne stanice. vrsta epitelnog tkiva sastavljenog od zametnih stanica iz kojih se u muškaraca razvijaju spermiji.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GERIJATRIJA. pokretni spermatozoidi. U muškaraca se germinativni epitel nalazi u sjemenicima. a poznate su livadne biljke maslačak. isp. probavnih. kasnije sjemenke. Uloga tih stanica je da štite živčane stanice. Stablo je snažno. sipe. Rad glatkog mišićnog tkiva nije pod utjecajem naše volje već njime upravlja autonomni ili vegetativni živčani sustav. prekidaju dormanciju i potiču klijanje sjemenki. Oči su im dobro razvijene. v. tratinčica i ivančica.

Žive u svim staništima. γ-GLOBULIN. dabrovi. Stvara ga aferentna (dovodna) arteriola (ogranci bubrežne arterije) koja ulazi u početni dio nefrona . Prema potrebi razgrađuje se u glukozu koja putem krvi dolazi do svih stanica gdje se koristi kao izvor energije. kemijski spoj. medu. Česti su građevni dijelovi bioloških membrana. Glodavcima pripadaju: vjeverice i puhovi. škroba. GLIKOZURIJA. Biljojedi su. hormon kojega izlučuje gušterača. organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s bjelančevinama. Služi kao neposredan izvor energije u stanici. Kroz glomerul se ne filtriraju krvne stanice i velike molekule bjelančevina iz krvne plazme (selektivna filtracija). ali i kao sastavni dio složenih šećera: saharoze. dikobraz. splet kapilara u obliku klupka koji je sastavni dio nefrona. Prema broju od šest ugljikovih atoma u svojoj molekuli glukoza je heksoza. kao zaliha energije u stanicama viših životinja i čovjeka. kemijski spoj. GLUKOKORTIKOIDI. GLIKOLIZA (anaerobna respiracija).v. GLIKOPROTEINI. početna faza disanja koja se odvija u citoplazmi biljnih i životinjskih stanica neovisno o prisutnosti kisika pa se još naziva i anaerobna respiracija (anaerobno disanje). GLUKOZA (grožđani šećer). zečevi. GLIKOGEN. održavajući sastav iona stalnim. Zajednički naziv te skupine reakcija jest aerobna respiracija (aerobno disanje). imunoglobulin. v. Kroz glomerul se filtrira krvna plazma u silazni krak nefrona. Sastoji se od nekoliko stotina kemijski vezanih molekula glukoze. Služi kao pričuvna tvar tj. Iz čahure izlazi odvodna (eferentna) arteriola. GLOBALNO ZAGRIJAVANJE ZEMLJE. GLIKOLIPIDI. laktoze. maltoze. osnovne građevne jedinice bubrega. Kemijska formula spoja glikogena je (C6H10O5)n. U slučaju kad u stanici nema dovoljno kisika pirogrožđana kiselina može se dalje razgraditi do ugljik(IV)-oksida i alkohola ili dvije molekule mliječne kiseline što ovisi o tipu stanice. učinak staklenika. GLODAVCI.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vlakna i kontroliraju izvanstanični prostor. v. GLIKOGENSKA ZRNCA. Ako u stanici ima dovoljno kisika tada se pirogrožđana kiselina nizom biokemijskih reakcija dalje razgrađuje u mitohondrijima sve do ugljik(IV)oksida i vode. štakori i miševi. a prema aldehidnoj funkcionalnoj skupini aldoza (aldoheksoza). U glikolizi se šećer glukoza razgrađuje do dvije molekule pirogrožđane kiseline uz oslobađanje dvaju atoma vodika i dvije molekule ATP-a. GLUKAGON. pojava glukoze u mokraći kod nekih bubrežnih bolesti.Bowmanovu čahuru. glikogena i celuloze. najbrojnija skupina sisavaca. Česti su građevni dijelovi bioloških membrana. Dolazi u slobodnom obliku u raznom voću. GLOMERUL (kapilarno klupko). Najviše se sintetizira i pohranjuje u jetri i mišićnom tkivu u obliku glikogenskih zrnaca. glikogen. organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s lipidima. 49 . kortikosteroidi. ugljikohidrat iz skupine monosaharida ili jednostavnih šećera kemijske formule C6H12O6. ugljikohidrat iz skupine polisaharida ili složenih šećera. Hrane se glođući prednjim parom dugačkih sjekutića koji rastu cijelog života. a stimulira razgradnju glikogena do glukoze u slučaju snižene razine glukoze u krvi (hipoglikemije). v.

Sastavljeno je od niza uskih i plosnatih kanalića koji su omeđeni membranama i poredani koncentrično. Srce je trodjelno ali je klijetka djelomično podijeljena na dva dijela. Gmazovi su hladnokrvne životinje jer se staničnim disanjem ne stvara dovoljno topline. Jaja polažu u zemlju ili pijesak. Oplodnja je unutarnja. (1844. Dišu samo plućima. Oni sadrže enzime koji mogu 50 . Po svojim osobinama su izdvojena evolucijska cjelina. GLJIVE (Fungi). gdje ih grije sunce. Jaja. kemijski spoj iz skupine aminokiselina. Osobine slične životinjskima su: stijenka hifa u većine gljiva je od hitina. koja legu na kopnu. Kod gmazova je razvijena briga za potomstvo. Žive u tropskim i suptropskim krajevima jer toplinu tijela održavaju sunčanjem. zelena pupavka (Amanita phalloides) koja izaziva najviše trovanja oštećujući jetru i koštanu srž. Saprofiti su ili paraziti. GMAZOVI (Reptilia). Ispred srca je venski zaton (proširenje vene). Neki gmazovi kote žive mlade. razvio metodu bojanja živaca i potkraj 19. mješinarke i stapčarke. Većina mjehurića spaja se sa staničnom membranom i oslobađa svoj sadržaj procesom egzocitoze. opip. Imaju sličnosti sa životinjama i biljkama. čiji je vanjski sloj izgrađen od sive moždane tvari. Mokraćovodi ulaze u nečisnicu. v. talijanski liječnik histolog. zaštićena su ljuskom i sadržavaju žumanjak potreban za razvitak embrija. U jajovodu se oko oplođenog jaja stvara čvrsta ovojnica. stanični organel koji se nalazi u citoplazmi svih vrsta eukariotskih stanica. krokodili i ljuskaši (gušteri i zmije). Koža gmazova je suha i pokrivena rožnatim ljuskama ili pločama (zaštita od isparavanja). Gmazovi na rašljastom jeziku imaju više osjetila (za miris. Neki od mjehurića ostaju u citoplazmi kao tjelešca za razgradnju. npr. u razmnožavanju postoji jasna izmjena generacija. Grubo ih dijelimo na: sluznjače. skupina kralježnjaka koja se prva u biosferi sasvim prilagodila životu na kopnu. kornjače. GLUTAMINSKA KISELINA. GOJAZNOST. njuh i sluh. DNK je sličnija životinjskoj nego biljnoj. treći bubreg).-1926. lizosomi. neke niže gljive imaju celuloznu staničnu stijenku. pričuvna hrana je glikogen.st. katkad i neke masti – nikada škrob. v. Tijelo gljiva nazivamo micelij koji je sastavljen od isprepletenih niti ili hifa. Oči imaju pokretljive očne kapke i prozirnu migavicu. neke se primitivne gljive hrane tako da uzimaju i probavljaju krute komade hrane. a sam je zametak obavijen zametnim ovojima (v. Za sakupljanje gljiva potrebno ih je pojedinačno dobro poznavati jer među njima ima i smrtno otrovnih.). pretilost. Posebno je dobro razvijen u žljezdanim stanicama. kemijski spoj iz skupine aminokiselina. Golgijevo tijelo. GOLGIJEV APARAT. S krajeva tih kanalića odvajaju se mjehurići čiji je sadržaj najčešće proteinske prirode. algašice. Dobro je razvijen prednji mozak. Osobine slične biljnima su: micelij je sličan steljci nižih biljaka i nerazlučen u tkiva. Po njemu su te strukture dobile ime Golgijevo tijelo. Uzrok je nedovoljna količina kisika zbog malog broja eritrocita i male dišne površine u plućima.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GLUTAMIN. Danas živi oko 6000 vrsta koje su podijeljene u skupine: premosnici. otkriva mjehuraste strukture u živčanim stanicama. C. GOLGI. velika i raznolika skupina heterotrofnih eukariotskih organizama. tzv. hranu uzimaju vanjskom površinom. kod zmija koje nemaju bubnjić). Za izlučivanje služe pravi bubrezi (v. GOLGIJEVO TIJELO (Golgijev aparat). amniota).

evolucijski starija i primitivnija skupina sjemenjača. u građevinarstvu. zajednički naziv za skupinu hormona koje izlučuje prednji režanj hipofize (adenohipofiza). pa se unutar njega razvija i embrio mlade biljke. Među izumrlim golosjemenjačama nalaze se i predci kritosjemenjača. GRAAFOV FOLIKUL (Graafov mjehurić). drvenaste biljke (stabla ili grmovi). v. Graafov folikul puca i zrela se jajna stanica zajedno s tekućinom mjehurića izbacuje u trbušnu šupljinu od kuda dospijeva u jajovod. 51 . Gametofit je jako reduciran i prehrambeno ovisan o matičnoj biljci. (1859.. GORJANOVIĆ-KRAMBERGER. a često uzrokuje i neplodnost.. Golosjemenjače su značajne: u izgradnji biljnog pokrova sjeverne polutke. obradio i objasnio fosilne ostatke Krapinskog pračovjeka. Neliječena gonoreja uzrokuje oštećenja srca i zglobova. Golemi su u usporedbi s tipičnim kromosomima veličine samo nekoliko μm. 20. zajednički naziv za muške i ženske spolne žlijezde u viših životinja. stoljeća na temelju pokusa s eritrocitima utvrdili da fosfolipidi u biološkim membranama čine dvosloj. Nastaju višestrukom replikacijom kromosomskih niti sastavljenih od DNA i proteina. i GRENDEL. U muškaraca i žena adenohipofiza izlučuje tri gonadotropna hormona: folikul-stimulirajući hormon (FSH). Obavijen je stanicama i ispunjen tekućinom. Sjemeni zameci. a kasnije i sjemenke nalaze se bez zaštitnog pokrova “goli” na sjemenim (plodnim) ljuskama ili listovima. spolna zarazna bolest čovjeka čiji je uzročnik bakterija gonokok. GONOREJA (kapavac). GONADOTROPNI HORMONI (GTH).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE razgrađivati proteine. Ženski gametofit (embrionska vreća) ne napušta sjemeni zametak. hortikulturi. GRAAFOV MJEHURIĆ.-1936. Izmjena generacija (gametofita i sporofita) je pravilna. Simptomi bolesti su peckanje u mokraćovodu i gnojni iscjedak za vrijeme i nakon mokrenja. Muški gametofit s dvije muške gamete razvija se unutar polenovog ili peludnog zrna (muške spore. nukleinske kiseline i lipide. a mogu se naći u nekim tkivima kukaca. GOLOSJEMENJAČE. GONADE. Dijele se na nekoliko skupina od kojih su najzastupljenije četinjače. hrvatski geolog. GTH potiču gonade na lučenje spolnih hormona i gametogenezu. F. a ako ne dođe do oplodnje i bijelo tijelo (corpus albicans). nizozemski biokemičari koji su 20-ih god. a kada sazrije. Među danas živućim golosjemenjačama razvojno su najprimitivnije ginko i cikas koji se oplođuju pomoću pokretnih muških gameta. Nakon ovulacije (sazrijevanja jajašca) sadržaj Graafovog folikula se mijenja te se od njega razvije žuto tijelo (corpus luteum). npr. mikrospore). politeni kromosomi). veliki kromosomi dužine nekoliko stotina μm (neki i 1000 μm) i promjera oko 50 μm. paleozoolog i paleoantropolog. tartufi. koji je otkrio. GOMOLJAČE. a ženske jajnici (ovariji). v. E. pteridosperme. Golosjemenjače su se razvile od predaka današnjih papratnjača. Oprašuju se vjetrom. U njemu sazrijeva jajna stanica. žlijezdama slinovnicama vinske mušice. U kralježnjaka muške spolne žlijezde su sjemenici (testisi). GORTER.). GOROSTASNI KROMOSOMI (gigantski kromosomi. mjehurić koji se stvara u jajnicima sisavaca oko jajne stanice. D. luteinizirajući hormon (LH) i luteotropni hormon (LTH). farmaciji. v. Graafov folikul.

v. GROŽĐANI ŠEĆER. kameleoni. U našoj zemlji poznate su npr. U unutarnjosti susrećemo zelembaće. primorska. egzokrina i endokrina žlijezda. zarazna bolest dišnih organa koju prati povišena temperatura. Za utvrđivanje gustoće populacije danas se primjenjuju različite metode. Na lubanji imaju kvadratnu kost za koju se drži donja čeljust. Najčešće skupine guštera su: macaklini. što omogućava gutanje većeg plijena. GUŠTERAČA (pancreas). 52 . hidrogen . Noge su im dobro razvijene. GUŠTERI. primjenjuje se približna procjena gustoće koja se izražava brojkama. novočeljuske.kahrbonatne ione i različite probavne enzime. eksperimentirao s bakterijama reda Pneumococcus i 1928. To je danas jedna od najčešćih bolesti koju uzrokuju virusi. H. GRENDEL. gutta = kapljica). te alfa . GRIFFITH. Funkcija hidrogen karbonatnih iona je neutralizacija sadržaja himusa prispjelog iz želuca. E. U uhu je bubnjić. v. isp. v. te najstariji i najprimitivniji ljuskaši. sljepiće i blavore. od 1 do 5. koji je otkrio Gram bojenje bakterija prema kojem se bakterije mogu podijeliti u dvije skupine: Gram-pozitivne i Gram-negativne bakterije. glukoza.). Usta se mogu široko otvoriti. Sadržava vodu. a broj 5 veoma brojnu vrstu. Većina ima tjemeno oko i pokretne očne kapke. siva i krška gušterica s mnogim endemičnim podvrstama na Jadranskim otocima. (1853. paučnjaci. dokazao mogućnost pretvorbe jednog tipa bakterije (bez sluzavog omotača) u drugi tip (sa sluzavim omotačem). gonadotropni hormoni. pri čemu broj 1 označuje veoma rijetku vrstu. Kapljice vode izlaze kroz hidatode ili puči vodenice. GTH. opća slabost i bolovi u mišićima. Tijelo im je pokriveno rožnatim ljuskama. Građena je od dvije vrste tkiva: žlijezdanog parenhima (acinusi) koji luči probavne enzime (vanjsko lučenje). GRIPA (influenca). tzv. To se zove samosakaćenje ili autotomija. Gušterača je smještena ispod želuca. danski bakteriolog. na dan se proizvodi u količini od 500 do 1500 mL. gušterice i sljepići..stanica i beta – stanica Langerhansovih otočića koji luče hormone glukagon i inzulin (unutarnje lučenje). pojava izlučivanja vode u obliku kapljica kod nekih biljaka.1 do 8. F. F. izražava se brojem jedinki neke vrste na nekom prostoru ili njihovom ukupnom masom u suhom ili svježem stanju (biomasom). Pojavljuje se kada je transpiracija vrlo slaba. predatori. GRINJE.. v. GUTACIJA (lat. v. god. krvotvorni organi. najbrojnija skupina današnjih gmazova. isp. lepra. GUBA. v.-1938. Mnogi gušteri mogu u slučaju opasnosti otkinuti rep. npr. Hrana su im uglavnom kukci i male životinje. Gripa može izazvati i upalu pluća. samoamputacija. Gorter. GRAM. v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GRABLJIVCI. a pH mu iznosi između 7. a koncentracija vlage zraka velika. GRANULOPOEZA. isp. v. GREBENKE. GUSTOĆA POPULACIJE.3. jer probavni enzimi u crijevu djeluju na neutralnom odnosno na blago alkaličnom pH području. a jedna od metoda je prebrojavanje ili vaganje jedinki skupljenih s prostora određene veličine. GUŠTERAČIN SOK. viroza. U slučajevima kada je prebrojavanje jedinki teško.

pričvršćuju u tkivo domodara i sišu hranjive tvari. njemački biolog koji je 1866. v. HAPLOIDAN BROJ KROMOSOMA. a u žena jajna stanica i on iznosi 23 (n=23). opažanja koja nastaju bez podraživanja osjetila. hipoteze o postanku mnogostaničnih životinja. npr. Nakon oplodnje novonastala zigota sadrži potpun. HADŽIJEVA HIPOTEZA POSTANKA METAZOA. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina. spolna generacija. Spore se razvijaju u spolnu generaciju koja ponovo proizvodi gamete. prizvodi gamete ili spolne rasplodne stanice u biljaka pa se zove gametofit (isp. HAMMERLING.. HAUSTORIJ. HALOFITI (biljke slanih staništa) biljke koje žive na tlu u kojem je prisutna veća količina soli. eritrociti. posebne sisaljke kojima se parazitske i poluparazitske biljke.. U muškaraca haploidan broj kromosoma imaju spermiji. Ovakav broj kromosoma rezultat je mejoze. god. specifičnog oblika diobe stanice pri kojoj nastaju gamete. Stapanjem muške i ženske gamete nastaje zigota. najčešće natrijevog klorida. tj. diploidan broj kromosoma i on iznosi 46 (2n=46). v. HALUCINACIJE. gametama i označuje se s n.). opojnim drogama ili dr. Ona se razvija u biljku. – 1919. odnosno oplodnje. tvorac plazmodijalne teorije postanka višestaničnih životinja (metazoa). HAPTERE. nja središnjeg živčanog sustava alkoholom. Pojavljuju se u umno poremećenih osoba ili zbog otrova- 53 .____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE GVANIN.). O H H2N N C C N C C N H N C H H HADŽI. eritrociti. v. polovičan broj kromosoma koji se nalazi u spolnim rasplodnim stanicama. pokusima na jednostaničnoj algi roda Acetabularia dokazao da jezgra određuje građu i oblik alge. J. J. HAECKEL. dvije duge prekrižene vrpce koje služe pri raznošenju spora vjetrom. hipoteze o postanku mnogostaničnih životinja. v. tj. Hb. HbA. koje žive na drugim biljkama. hemoglobin. Haptere se smotaju ako se spora spusti na vlažno i pogodno tlo. Uveo naziv “ekologija”. Nakon stapanja gameta. uspostavlja se ponovo diploidan broj kromosoma. HAPLOIDNA GENERACIJA. predložio naziv protisti za jednostanične organizme. a broj kromosoma se od početnog broja smanjuje na polovicu. Razvili su različite prilagodbe koje im omogućuju preživljavanje kao. (1834. zoolog. HAECKELOVA HIPOTEZA POSTANKA METAZOA. E. sporofit (nespolna generacija) koji je diploidan i proizvodi spore. v. kod preslica. organski spoj s dušikom iz skupine purinskih baza.. izlučivanje soli pomoću žlijezda (kod vrste Avicennia). HbF.

Oboljevaju uglavnom muškarci. imela). HEMOLITIČKA ANEMIJA. kliješta na prednjem tijelu (uz usta) kod klještara. Hematokrit zdrave osobe je 45 % (indeks 0. eritrocita. plazmatski red. odnosno krvi.45). limfocitne. HEMOFILIJA. trombocitni red. Kod nekih su povezana s otrovnom žlijezdom kojom usmrćuju plijen. HELICERE. poluparazit. fruktoza i galaktoza. Zbog stvaranja veće količine bilirubina javlja se i žutica. Osnovne matične krvotvorne stanice nalaze se u koštanoj moždini i mogu se neograničeno reproducirati. HEMATOPOETSKI ORGANI. Najčešće nedostaje antihemofilijski globulin -faktor VIII. granulocitni red). a prenose je žene. v. Određuje se centrifugiranjem krvi u tankoj baždarnoj kapilari. Te matične (pluripotentne) stanice mogu se diferencirati u usmjerene krvotvorne stanice (eritrocitne. HEMOCIJANIN. Pigment hem se sastoji od protoporfirinskog dijela i iona željeza za koji se veže kisik. HEMATOKRIT. stvaranje krvnih stanica. HEMOGLOBIN (Hb). hemisis = polovica. HEMIPARAZIT (grč. monocitne. monocitni red. bentos. razvojni slijed. biljna vrsta koja živi na drugoj biljci ali sadrži klorofil i može fotosintezom sintetizirati ugljikohidrate. Najvažniji je dio crvenih krvnih stanica. To je krvni ili dišni pigment kod mekušaca te služi za vezanje i prijenos kisika. Hematopoeza počinje već prvih tjedana zametnog razvoja u žumanjčanoj vrećici. trombocitne i granulocitne). Sastoji se od međusobno vezanih bjelančevine globina i organometalnog spoja hema.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ HEKSOZE. HEMATURIJA. eritrociti do 120 dana a neke vrste leukocita nekoliko dana do oko 100 dana. Daljnji tijek diferencijacije je različit za pojedine redove stanica (eritrocitni red. pojava eritrocita u mokraći kod nekih bubrežnih bolesti. HEMISESILNI ORGANIZMI. kemijski spoj sličan hemoglobinu. limfatični red. HEMIZIGOTI. Služe za hvatanje plijena i obranu. jednostavni šećeri ili monosaharidi koji sadrže šest ugljikovih atoma u svojoj molekuli. HEMATOPOEZA. glavnina se kisika veže na hemoglobin eritrocita. haustorija (npr. organizmi koji imaju samo jedan alel za jedno svojstvo. Heksoze su glukoza. 54 . ali umjesto željeza sadrži bakar. Nakon difuzije u krv. krvotvorni organi. parasiteo = jedem zajedno s nekim). v. krvni pigment koji daje crvenu boju eritrocitima. a vrlo mala količina kisika se prenosi otopljena u krvnoj plazmi. Gen koji je odgovoran za nastanak ove bolesti nalazi se u spolnom x kromosomu. nasljedna bolest koja se očituje u nesposobnosti zgrušavanja krvi. Sudjeluje u izmjeni plinova (kisika i ugljikovog dioksida) u tijelu. HEMATOPOETSKI REDOVI STANICA. Odlikuje se nedostatkom jednog od brojnih kemijskih tvari nužnih u procesu zgrušavanja krvi. plazmatske. volumni udio krvnih stanica i trombocita u krvi. bolest koja se javlja kada se eritrociti raspadaju brže nego što se stvaraju. a mineralne tvari i vodu crpi iz ksilema domadara u koji prodire pomoću sisulja. stanice koje čine jedan morfološki. a kasnije se odvija u ostalim hematopoetskim tkivima i organima. Krvne stanice žive u opticaju krvi ograničeno dugo: npr.

heterozigot Aa u svojem vanjskom izrazu (fenotipu) nosi izgled dominantnog gena 55 . svojstvo odbijanja vode. HIDROFITI. Hidrolazama pripadaju proteaze koje proteine razgrađuju na peptide i aminokiseline. virusna bolest koja obično uzrokuje promjene na koži u obliku mjehurića. biljke koje žive u vodenim ekosustavima. gušteračin sok. HIDROLITIČKI ENZIMI (hidrolaze). hidrolitički enzimi. HIBRID. a od biljaka heterotrofne bakterije i gljive. HERMAFRODIT. svojstvo privlačenja vode. žlijezde za izlučivanje vode procesom gutacije kod nekih biljaka. v. HIDATODE. HETEROTROFI (heterotrofni organizmi). Nalaze se na rubovima listova. Hidrofobne su neke nepolarne molekule (različiti ugljikovodici itd. heterotrofi. HERBIVORI. amini itd. HEMOLIZA. organizmi koji nemaju sposobnost stvarati vlastite organske spojeve. organizmi koji nose različite alele za neko svojstvo jer su nastali spajanjem gameta koje su bile različite za dotično svojstvo. monohibridno križanje s dominacijom) ili a1a2 (heterozigot za jedno svojsvo. Hidrofilne su neke molekule koje se odlikuju polarnošću (kiseline. fetalna eritroblastoza. HIBRIDIZACIJA. U heterotrofe se ubrajaju sve životinje i čovjek. križanci. lopoč). hibridi). HIDROGEN KARBONATNI IONI. Aa (heterozigot za jedno svojstvo. drugi naziv za biljojede. v. HENLEOVA PETLJA. dvospolac. v. ali ipak u sebi nosi i prikriveni recesivni gen (a). v. a najčešći je herpes febrilis koji se manifestira na usnama i okolnoj koži. već ih moraju uzimati hranom. alkoholi. a drugima samo cvjetovi i neki listovi plivaju površinom ili se izdižu iznad nje (lokvanj. v. v. dihibridno križanje s dominacijom) ili AaBB (heterozigot za jedno od dva svojstva. U opisima primjera križanja heterozigoti se označuju npr. skupina enzima koji sudjeluju u razgradnji različitih molekula u manje sastavne dijelove uz ugradnju molekule vode. hemolitička anemija i transfuzijska reakcija. Neke su posve u vodi (vodena kuga. zimski san. HIDROLAZE. ispod puči vodenica. krocanj). HETEROTROFNI ORGANIZMI. šuljevi. HIDROFILNOST.).). obrubnjaci. monohibridno intermedijarno križanje) ili AaBb (heterozigot za oba svojstva. hidrofilnost. HERPES. v. v. raspadanje eritrocita. HIDRANTI. HERBICIDI. HIDROFILNE TVARI. kemijska sredstva za uništenje korovnih biljaka. v. križanac. v. lipaze koje kataliziraju hidrolizu lipida na glicerol i masne kiseline. Primjerice. HIBERNACIJA . HEMOROIDI v. HIDROFOBNOST. dihibridno križanje s dominacijom). (A). heterozigoti. esteraze koje pospješuju hidrolizu estera na njihove alkohole i kiseline te nukleaze koje ubrzava- HETEROZIGOTI (heterozigotni organizmi. v. HETEROZIGOTNI ORGANIZMI v. v. Postoji nekoliko različitih tipova herpesa. križanje.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE HEMOLITIČKA BOLEST NOVOROĐENČADI. nefron. pojedini polipi u zadruzi kod žarnjaka.

kao npr. Higrofiti često imaju velike listove s tankom epidermom i mnogim pučima. Građena je od tri režnja: prednji režanj (adenohipofiza). Povećani su frekvencija disanja i rad srca. HIPERPARATIREODIZAM. vegetativno tijelo gljiva. kao npr. stanje povišene razine glukoze u krvi. tanka opna u predvorju rodnice. guša (gušavost). HIPERTIREOZA. mora i oceani. Na primjer. Nalazi se na bazi mozga. taksija. HIGROFILNE ŽIVOTINJE (grč. HIMEN (djevičanski zalistak). Dolazi do prekomjernog lučenja hormona tiroksina koji povećava bazalni metabolizam. Npr. vodozemci. HIPERTONIČNA OTOPINA je otopina koja ima veću koncentraciju otopljenih tvari od normalne. v. puževi golaći i gujavice. ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. oboljenje krvnih žila. mješinarke. Normalna koncentracija glukoze u krvi (GUK) iznosi oko 5.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ju razgradnju nukleinskih kiselina i oslobađanje nukleotida. metabolički poremećaj zbog prekomjerna lučenja paratireoidnog hormaona (parathormona). manjih ili većih otvora kroz koje može istjecati menstruacijska krv. Svi probavni enzimi su hidrolaze. vode tekućice i stajaćice. koje postaju krhke i lako lomljive. posebni stanični organeli. U nekih osoba se može pojaviti oteklina na vratu. HIPERGLIKEMIJA. Može sadržavati jedan ili više. Izlučuje veliki broj hormona od kojih neki utječu na izlučivanje hormona ostalih žlijezda s unutarnjim izlučivanjem. Ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. v. Suprotno od hipoglikemije je hiperglikemija ili stanje povišene koncentracije glukoze u krvi. želudac. hipertenzija. v. neki šaševi i žabnjaci. onaj koji ima veći potencijalni osmotski tlak (π*. U stanici. Zemljina vodena ovojnica. hygros = vlažan. jedna od najvažnijih žlijezda s unutarnjim izlučivanjem. HIFE. HIMENIJ. HIJAZMA. fyton = biljka). biljke koje žive u vlažnim šumama i livadama. srednji režanj (pars intermedia) i stražnji režanj (neurohipofiza). tj veći potencijalni osmotski tlak od normalnog. hygros = vlažan. a veličine je zrna graška. HIPOFIZA. tjelesna tekućina može biti hipertonična gubitkom dijela (otapala) vode ili unošenjem u tijelo većih količina otopljenih tvari. Dolazi do povećane razine kalcija u krvi. stanje povišenog krvnog tlaka koje najčešće prati aterosklerozu.5 mmol/L. HIDROTAKSIJA. stanje snižene razine šećera glukoze u krvi. Kalcij se gubi iz kostiju. HIMUS. koja remeti tjelesni metabolizam. HIGROFITI (grč. a povećan promet kalcija kroz bubrege može uzrokovati pojavu bubrežnih kamenaca. HIPERTENZIJA (hipertonija). 56 . mjesto “prekopčavanja” dijelova pojedinih kromatida homolognih kromosoma u crossing overu. pretjerana aktivnost štitnjače. filos = prijatelj). tj. nitaste tvorevine koje izgrađuju micelij. HIDROSFERA. v. HIPERTONIČAN. životinje koje mogu živjeti samo u izrazito vlažnoj atmosferi ili u vlažnom tlu. HIPOGLIKEMIJA. HIPERTONIJA. on raste s koncentracijom otopljene tvari). lizosomi obiluju tim enzimima.

HISTAMIN. HIPOTENZIJA (hipotonija). stanje smanjenog lučenja tiroksina. crvenilo. kemijski spoj iz skupine aminokiselina. nedostatak vitamina C uzrokuje skorbut. HIPOTALAMUS. srpasta anemija). stanice su se specijalizirale za različite zadaće: hranjenje. Unutar takve zadruge postojala je podjela rada. Dolazi do smanjenja razine kalcija u krvi. S vremenom su se pojedine jezgre okružile s nešto citoplazme. otežani su disanje i rad srca uz slab razvitak koštanog tkiva i zuba. Na primjer. ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju. mrlje. Može uzrokovati endemsku gušavost ili kretenizam. slične današnjim žarnjacima. stanje sniženog krvnog tlaka. razmnožavanje. v. Hadžiju prve mnogostanične životinje bile su bilateralno simetrične i pokretne. HIPOTEZE O POSTANKU MNOGOSTANIČNIH ŽIVOTINJA U suvremenoj filogeniji iskristalizirale su se dvije hipoteze o postanku mnogostaničnih životinja (metazoa). biogeni amin. HIPOTONIJA. gubitkom mineralnih tvari ili uzimanjem hrane s premalo (otpljenih) mineralnih tvari. HISTOGENEZA. t. onaj koji ima manji potencijalni osmotski tlak (π*). svrbež i otežano disanje. Npr. HIPOTONIČNA OTOPINA je otopina koja ima manju koncentraciju otopljenih tvari od normalne. zaštita. Histamin izaziva simptome kao što je prekomjerno izlučivanje sluzi. smanjeno lučenje parathormona. slične primitivnim virnjacima i razvile su se iz mnogojezgrenih trepetljikavih oblika praživotinja.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE HIPOPARATIREODIZAM. nedostatak vitamina A uzrokuje noćnu sljepoću. Ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju. HIPOVITAMINOZA. a nedostatak vitamina D poremećaj u metabolizmu kalcija koji dovodi do rahitisa. a središnji sloj hranidbenu zadaću. termoregulaciji. u hipotalamusu se stvaraju faktori za oslobađanje gonadotropnih hormona koji dolaze u hipofizu i potiču je na lučenje gonadotropnih hormona. zaštitnu i osjetilnu. Haeckelu mnogostaničari su se razvili iz zadružnih kolonijalnih prabičaša od nekoliko tisuća bičastih združenih stanica (kolonijalna teorija). U njemu se stvaraju i različite tvari koje reguliraju rad hipofize. npr. Prema J. 57 . nedostatak vitamina u organizmu koji može izazvati različite poremećaje. produkt stanica imunološkog sustava za vrijeme alergijske reakcije. Na primjer. jedna od etapa embrionalnog razvitka većine višestaničnih životinja u kojoj se formiraju tkiva. Prema E. Prvobitne su metazoe bile zrakasto simetrični oblici. HIPOTIREOZA. Dolazilo je do više mitotskih dioba jezgara bez podjele tijela praživotinje. hipotenzija. obavile staničnom membranom i preuzimale različite funkcije: površinski sloj stanica pokrovnu. promjene na koži. HIPOTONIČAN. npr. Hipotireoza se javlja zbog nedostatka joda u hrani ili vodi za piće. tkivni hormon. HISTIDIN. nedostatak vitamina B kompleksa uzrokuje različite metaboličke bolesti i promjene (dermatitis. javljaju se grčevi mišića. tjelesna tekućina može biti hipotonična razrjeđenjem većim količinama vode. sastavni dio međumozga koji ima važnu ulogu u regulaciji različitih vegetativnih funkcija organizma. tj manji potencijalni osmotski tlak od normalnog.j. Teorija se naziva i plazmodijalna jer se masa citoplazme s mnogo jezgara obično zove plazmodij.

HOMEOSTAZA je održavanje stalnih. ruka čovjeka i krilo šišmiša. HISTONI. vrsta iz roda Homo (čovjek) s vidljivim ljudskim obilježjima. Kod biljaka su bodlja kaktusa i list neke druge biljke istog podrijetla. a funkcija im može biti različita. HOMOLOGNI GENI. Starost nalaza ove vrste je između 300 tisuća i 2 milijuna godina. odnosno kromosome. organi u raznih skupina organizama koji imaju isto evolucijsko podrijetlo. aleli. Najpoznatiji nalazi ove vrste su javanski pračovjek ili pitekantropus s otoka Jave i kineski pračovjek ili sinantropus iz blizine Pekinga u Kini. HOMOLOGNI ORGANI (grč. vilina kosa. Bića koja su pripadala ovoj vrsti imala su volumen mozga oko 1000 cm3. U probavnim mjehurićima bičastih stanica hrana se djelomično ili potpuno probavi. vrsta kojoj pripadaju današnji ljudi. Smatra se da su i neandertalski i krapinski pračovjek izumrle rase ove vrste. isp. nego sve hranjive tvari crpi od domadara (npr. HOMO SAPIENS (umni čovjek). nepromijenjenih optimalnih životnih uvjeta u tijelu. monohibridno 58 . HOANE (choane). v. HOLOPARAZIT (grč.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ HISTOLOGIJA. Hoanociti stvaraju struju vode iz koje uzimaju hranu i kisik. Homeotermni organizmi su ptice i sisavci. volovod i potajnica). kromosomi koji su po vanjskim osobinama međusobno slični. biljna vrsta koja živi parazitski na drugoj biljci i ne sadrži klorofil te ne može stvarati organske spojeve fotosintezom. AIDS. organizmi koji su u stanju održavati stalnu tjelesnu temperaturu neovisno o vanjskim ili unutarnjim čimbenicima. holos = potpun. logos = govor. a drugi član od oca. gotovo uspravan hod i upotrebljavala su dobro isklesano oruđe i vatru. isp. HOANOCITI. v. HOMO ERECTUS (uspravni pračovjek). HOMOLOGNI KROMOSOMI. znanost o biljnim i životinjskim tkivima. organizmi koji nose iste alele za neko svojstvo jer su gamete iz kojih su ti organizmi nastali sadržavale iste alele za dotično svojstvo. potpuni parazit. dodatak 5. isp. npr. a gotovo se nije razlikovao od današnjeg čovjeka. HOMEOTERMNI ORGANIZMI. skupina bjelančevina bazične naravi koje vezane s DNA i nekim drugim bjelančevinama izgrađuju kromatin. Ovoj vrsti pripada i kromanjonski ili fosilni čovjek koji je živio prije 30 do 40 tisuća godina. U opisima primjera križanja homozigote označujemo npr. v. Iako su naizgled vrlo različiti. U svim tjelesnim stanicama onih organizama koji su nastali oplodnjom od dvaju roditelja. riječ). HIV (Human Immunodeficiency Virus). parasiteo = jedem zajedno s nekim). unutarnji nosni otvori kod nosnoprolaznica. U tjelesnim stanicama čovjeka nalazi se 46 kromosoma od kojih su 22 para autosoma (kromosomi koji ne određuju spol) i 1 par spolnih kromosoma tipa xx (u žena) ili xy (u muškaraca). kod spužve bičaste stanice koje okružuju spongocel. oni su posve jedinstveno građeni. s AA (dominantan homozigot. glavni sastojak oklopa člankonožaca i stijenki hifa u većine gljiva. HOMOZIGOTI (homozigotni organizmi). HITIN. homoios = isti. homologni kromosomi dolaze u parovima gdje jedan član svakog para potječe od majke. polimer glukozamina. spužve. noga vodozemca.

svaki prethodni član u lancu svojom brojnošću osigurava opstanak slijedećem članu. U svakom hranidbenom lancu svaki prethodni član mesojed je manji od slijedećeg člana u lancu. HOMOZIGOTNI ORGANIZMI.).potičem). hormao . – 1703. HRSKAVICA. čija brojnost mora biti manja. STH). tkiva i organizama u laboratorijskim uvjetima. proizvođač → planktonski račić. monohibridno križanje s dominacijom). mekši dio kostura. v. član. Tako je i ukupna biomasa svakog idućeg člana hranidbenog lanca sve manja. tvar koja se dobiva od nekih vrsta crvenih alga. HRSKAVIČNO TKIVO. Kod nasljeđivanja dominantnih i recesivnih obilježja recesivni gen može doći do izražaja samo u slučaju homozigotnosti (aa) jer ga onda ne nadjačava njegov dominantni alel. svitak. R. potrošač-biljojed → riba ukljeva. morske ribe (isp. HRANJIVE PODLOGE. potrošač-mesojed 1 → riba pastrva. V. lanac čiji su članovi povezani odnosima ishrane. kemijske tvari koje u krv luče žlijezde s unutarnjim izlučivanjem ili endokrine žlijezde. dihibridno križanje s dominacijom) i sl. Različite oblike hranidbenih lanaca susrećemo u svakoj biocenozi. v. dihibridno križanje s dominacijom) ili AABb (dominantan homozigot za samo jedno od dva svojstva. v. hrskavično tkivo.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE križanje s dominacijom) ili s aa (recesivan homozigot. IV. grkljanu i dušniku. HRANIDBENI LANAC. AABB (dominantan homozigot za oba svojsva. HORMON RASTA (somatotropni hormon. Primjer hranidbenog lanca jezera: planktonska alga. hormon kojega luči prednji režanj hipofize (adenohipofiza). hrskavično tkivo. član. isp. HOOKE. vrhu nosa. najpoznatija hranjiva podloga za uzgoj bakterija je agar. (1635. Većinom je završni član veličinom tijela najkrupniji. ICSH. potrošač-mesojed 2 → ptica kormoran. sastoji se od hrskavičnih stanica povezanih elastinom i hijalinom. Po kemijskom sastavu djelimo ih na bjelančevinaste i steroidne hormone. isp. kao i ukupna energija. a samim tim i rast organizma. član. podloge koje sadrže sve potrebne tvari za uzgoj i razvitak stanica. III. HORMON STIMULACIJE INTERSTICIJSKIH STANICA. v. U hrskavičnoj 59 . v. potrošač-mesojed 3. Također. homozigoti. djeluje na sve stanice tijela i stimulira u njima anabolitičke reakcije (reakcije sinteze). Koristimo također oznake a1a1 (intermedijarni homozigot. član. Dolazi u zglobovima i na mjestima gdje se kosti povezuju međusobno. Hrskavično se tkivo umnožava djelovanjem stanica hondroblasta. Nakon njih dolaze mnogobrojne serije potrošača (konzumenata).) sa hrskavičnim kosturom. Na prvom mjestu hranidbenih lanaca redovito su autotrofni proizvođači. engleski mikroskopičar koji je prvi spomenuo stanicu 1665. HRSKAVIČNJAČE. Na primjer. HORDA. HONDROBLAST. Građena je od hrskavičnog tkiva. II. v. član. On je pod svojim jednostavnim mikroskopom promatrao tanke prereze pluta i ugledao strukturu poput pčelinjeg saća te njezine sastavne dijelove nazvao stanicama. FSH. monohibridno intermedijarno križanje). a razara s pomoću hondroklasta. HONDROKLAST. a nalazimo je i u vanjskom uhu. I. god. HORMONI (grč. HORMON STIMULACIJE FOLIKULA.

Aktivna imunizacija postiže se cijepljenjem. hormon za stimulaciju intersticijskih stanica). Taj je poremećaj uzrokovan najčešće bolešću pojedinih organa imunohematopoetskog sustava (koštana srž. Razlikujemo dva osnovna tipa imuniteta: prirođeni (nespecifični) i stečeni (specifični) imunitet. Koža im je prekrivena romboidnim ljuskama sa zubićima (plakoidne ljuske). Nemaju plivaći mjehur. IMUNITET. U žena se taj proces zbiva 7. kojim se povećava površina za uzimanje hrane. otpornost organizma prema različitim uzročnicima bolesti kao i prema svim organizmu stranim tvarima. Tanko crijevo ima nabor. Djeluje na intersticijske stanice sjemenika koje izlučuju spolne hormone. oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara cirkulirujuća protutijela. začahurene ličinke trakavice. sisavaca. IMUNOGLOBULINI (Ig.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ kralježnici imaju i svitak. a neki su morski psi i živorodni. ICSH u muškaraca isto je što i LH u žena. v. a pasivna najčešće ubrizgavanjem protutijela proizvedenih u nekoj drugoj jedinki. Interstitial Cell Stimulating Hormone. Prirođeni imunitet postoji od samog rođenja i štiti organizam od svih antigena. IMUNODEFICIJENCIJA (imunoinkompetencija). Oplodnja je unutarnja. dana nakon oplodnje. IMUNIZACIJA. ILEUM. tanko crijevo. Stečeni imunitet stječe se tijekom života prema točno određenim antigenima kada oni dospiju u organizam. zavojiti zalistak. Usta su im s donje strane glave položena poprečno na uzdužnu os. proteini koji se nalaze u krvnoj plazmi. Dišu preko škržnih pukotina na površini tijela. a čija je uloga da kao antitijela štite orga- I ICSH (engl. IMPLANTACIJA JAJAŠCA. Morske mačke i psi legu jaja. Najbrojnija skupina su prečnouste. Može biti prirođena ili stečena (AIDS) imunodeficijencija. nesposobnost organizma da se brani od infekcije zbog nedostatne funkcionalne sposobnosti imunološkog susutava. Najpoznatije hrskavičnjače su morski psi. poput mjehurića i veličine oko 1 cm. i 8. ali i u drugim organima. Na pojavi imune memorije temelji se zaštita od različitih bolesti aktivnom. timus). U ikrici nespolnim razmnožavanjem nastane mnogo nepotpuno razvijenih mladih trakavica. limfni čvorovi. IKRICA. morske mačke. γ-globulini).stanice jer se one duže zadržavaju u organizmu. raže i drhtulje. za razliku od primarne reakcije koja nastaje pri prvom ulasku antigena u organizam. limfociti B. proces pri kojem se u opetovanoj zarazi javlja brža i burnija reakcija protiv tog istog antigena. ili pasivnom imunizacijom. HUMORALNA IMUNOST. v. jedan od tri gonadotropna hormona koje izlučuje prednji režanj hipofize. imunoglobulin. Ig. Taj tip imunološke reakcije nazivamo sekundarnom reakcijom. Mužjakove podrepne peraje služe za parenje. IMUNA MEMORIJA (imunološko pamćenje). Ikrica se razvija u mišićima. proces “ukopavanja” jajne stanice u sluznicu maternice koji se događa nakon oplodnje u 60 . v. postupak kojim organizam na umjetni način stječe imunitet. Nositelji imune memorije su plazma .

U G0-fazi su stanice koje se ne dijele. G1-faza (od engl. IMUNOLOŠKO PAMĆENJE. gap = prekid. čeljusti i prvenstveno u lijevu ruku. synthesis = sinteza) karakterizirana je udvostručavanjem DNA što je osnova za udvostručenje svakog pojedinog kromosoma. imunološki specifični odgovor organizma nakon ulaska antigena . proces fosilizacije pri kojemu se na površini organizama istaloži mineralna tvar i tako sačuva vanjski oblik organizma. Otkriveno je da su glavnu ulogu u povećanju postotka tamnih leptira imale mutacije i predatori. INFLUENCA. Čine ga imunosna tkiva i organi: timus. Imunosna tkiva i organe djelimo na središnje (imaju prvu ulogu u proizvodnji i raseljavanju stanica značajnih za obranu tijela. Sastoji se od prepoznavanja antigena i reakcije protiv tog istog antigena stvaranjem antitijela (protutijela) tj. pa se brojnost tamnih oblika povećava. INSPIRACIJSKO SREDIŠTE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE nizam od zaraze. IN VITRO FERTILIZACIJA (izvantjelesna oplodnja). Imunoglobulini se specifično vežu za stranu česticu (antigen) u antigen – protutijelo kompleks te tako učine antigene nedjelotvornim. imunitet. IgE. a ostvaruje se slanjem spontano nastalih električnih impulsa do ošita i ostalih inspiracijskih mišića. koštana moždina. to su timus i koštana moždina) i periferne (razvili su se pod kontrolom primarnih organa. Traje najdulje. IMUNOTOKSIČNI OTROVI. INFARKT SRČANI. IMUNOSNI (imunološki) SUSTAV. Nastaju u plazma – stanicama. imunoglobulina. vrsta prirodnog odabira gdje se povećava broj tamnih organizama (npr. S. te stanice u funkciji obrane tijela od infekcije: fagociti (mikrofagi i makrofagi) i limfociti. v. otrovi koji dovode do slabljenja imunološke reakcije na različite mikrobe (npr. INSEKTICIDI. Primjenjuje se u liječenju bračne neplodnosti. v. oplodnja jajne stanice u laboratorijskim uvjetima izvan tijela žene. INKRUSTACIJA (lat. osigurava tijelu imunitet. Dijelimo je na tri faze: G1. već obavljaju određenu funkciju. limfni čvorovi te limfatičko tkivo) organe. G2 i G0. kemijska sredstva protiv kukaca nametnika i štetnika. jaz) karakterizirana je sintetiziranjem RNA i bjelančevina u stanici što znači da stanica raste i da se njezin volumen povećava. leptira brezove grbe) u industrijskim područjima. IMUNOST. crusta = kora). G2-faza je (najkraće) razdoblje kada se stanica priprema za diobu. INDUSTRIJSKI MELANIZAM. v. Poznato je pet vrsta imunoglobulina: IgA. S-faza (od engl. gripa. stečena imunost. U njemu se stvara osnovni ritam disanja. IgG i IgM. INDUCIRANE MUTACIJE. imuna memorija. slezena i limni čvorovi. Glavni simptom srčanog infarkta je jaka bol u sredini prsnog koša koja se širi u područje vrata. IgD. INTERFAZA. nalazi se u produženoj moždini. v. v. to su slezena. U različitih vrsta stanica traje različito. razdoblje u životu stanice između dviju jezgrinih dioba. 61 . Svijetle oblike leptira ptice lakše uočavaju na tamnoj podlozi i uzimaju ih za hranu. IMUNOLOŠKA REAKCIJA. v. odumiranje dijela srčanog mišića zbog neprokrvljenosti koja može nastupiti ako se smanji ili obustavi protok krvi kroz koronarne arterije. pesticidi). in = u. lijekovi. mutacije. tromboza i ateroskleroza.

specijalizirane stanice sjemenika koje leže između sjemenih kanalića. IZVANTJELESNA OPLODNJA. hranjive se tvari probavljaju u probavnim vakuolama praživotinja. Smanjeno izlučivanje inzulina ili potpuni prestanak izlučivanja zbog oštećenja gušterače uzrokuje šećernu bolest (dijabetes). v. Nalazimo ih kod npr. mehaničkih) izola- cijskih mehanizama. tj. obrnuti poredak gena jednog kromosomskog segmenta. globulina i fibrinogena koje imaju značajnu ulogu u raznolikoj funkciji krvi. INZULIN. tj. kromosomska promijena. Tako omogućuje oksidativnu razgradnju ili pospremanje glukoze u glikogen. ograničenje izmjene gena između jedinki zasebnih populacija. mehanizmi očuvanja genoma pojedinih vrsta. U ljudskom tijelu je ima oko 15 litara. IVANOVSKI. međusobno jednake nespolne rasplodne stanice (spore). među populacijama ili dijelovima populacija raznih vrsta tako da se međusobno ne dodiruju (geografska ili prostorna izolacija) ili se ne miješaju zbog npr. Sprečavaju razmnožavanje virusa u organizmu. izmjena haploidne i diploidne generacije u biljaka. IZOLACIJA (tal. tj. Izolacijski mehanizmi se dijele na vanjske ili mehanizme prije parenja i unutarnje ili mehanizme poslije parenja. Ako živu stanicu stavimo u izotoničnu otopinu voda neće osmozom ni ulaziti u nju ni izlaziti iz nje. IZOLACIJSKI MEHANIZMI. žućkasta tekućina koja se bitno ne razlikuje od međustanične tekućine osim što plazma sadrži veću količinu specifičnih bjelančevina albumina. INTRACELULARNA (unutarstanična ) PROBAVA. oko 13 litara. god. isolare = odijeliti. in vitro fertilizacija. jednak). IZOSPORE (grč. etoloških ili spolnih (morfoloških. osobito u stanicama jetre i u mišićima. INVERZIJA. hormon kojega izlučuje gušterača. IZDANAK. stabljika s listovima u kopnenih biljaka. IZMJENA GENERACIJA. Ostatak je krvna plazma. imaju endokrinu ulogu. kemijski spoj iz skupine aminokiselina. osamiti).4. Rezultat djelovanja inzulina je sniženje razine glukoze u krvi. 62 .. IZOLEUCIN. IZOTONIČNA OTOPINA je otopina koja ima isti osmotski tlak kao stanična tekućina. Glavni sastojci su voda. bjelančevinaste tvari koje stvara imuni sustav. prvi upozorio na postojanje virusa. ekoloških. Krvna plazma zajedno s krvnim stanicama čini punu krv. Međustanična tekućina čini najveći dio izvanstanične tekućine. One luče spolne hormone. paprati i preslica. Izolacija predstavlja jednu od pokretačkih sila evolucije. isp.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ INTERFERONI.J. ruski znanstvenik koji je istražujući mozaičnu bolest duhana 1892. isos = isti. D. INTERSTICIJSKE STANICE (Leydigove stanice). a pomaže pri transportu glukoze iz krvi u stanice. Ljudska izvanstanična tekućina ima pH 7. natrijev kation (Na+) i kloridni ion (Cl–). Na taj se način zaštićuje genetička cjelovitost vrste. IZVANSTANIČNA TEKUĆINA nalazi se u tijelu izvan stanica. odijeljenost među životnim skupinama biljaka ili životinja. odnosno krvna plazma kada su koncentracije njihovih otopljenih tvari normalne.

postavivši dvije leće na određenu međusobnu udaljenost dobio povećanu sliku promatranih predmeta. tj. jajna stanica. v. JEDNOSUPNICE. v. Najpoznatija je vrsta čudnovati kljunaš. Izgleda poput cijevi ili kanala. JEDNOSTRUKA MEMBRANA. JEDNJAK. mitohondrije i kloroplaste. U žena je to parni organ čija je uloga prihvaćanje jajne stanice iz trbušne šupljine i provođenje do maternice. Ocvijeće i prašnici većinom s 3 člana u krugu. kukuruz) i ljiljani (npr. dio ženskog spolnog sustava mnogih beskralježnjaka i svih kralježnjaka. Ocvijeće nerazlučeno u čašku i vijenčić. Najčešće su porodice i njihovi predstavnici: trave (npr.st. v. tanka ovojnica (7-10 nm) koja obavija stanicu. između žila nema međusobno mrežasto povezanih žilica. bez kambija. Žile u stabljici nepravilno raspoređene. JAJNA STANICA (jajašce. Nervatura lista prugasta. JAJOVOD (tuba uterina). nizozemski optičar koji je u 16. Bio je visine oko 145 cm s volumenom mozga do 900 cm3 i imao je gotovo uspravan hod. U njemu se u normalnim uvjetima zbiva oplodnja jajne stanice. razred kritosjemenjača. ugljikohidrati. Osim što se u njima odvija proces stvaranja ženskih spolnih stanica (oogeneza). Iz žljezdanih se stanica luče sekreti koji hrane jajnu stanicu i zigotu te održavaju blagu lužnatost sredine. tulipan. jedan od izumrlih oblika čovjekovih predaka koji se danas ubraja u vrstu uspravnog pračovjeka (Homo erectus). JEDNOOTVORI. U žena. JEDNODOMNE BILJKE. mišićna cijev između ždrijela i želuca. pšenica. najprimitivniji današnji sisavci. JAJE. jajna stanica se razvija i sazrijeva u jajniku (ovariju) unutar Graafovog folikula. v. Osim jednostruke membrane u eukariotskim stanicama se nalazi i dvostruka membrana koja obavija jezgru. jajna stanica. cvijet. Žile zatvorene. riža. uzastopnim steza- 63 . Ovalnog su oblika. ženska spolna rasplodna stanica ili ženska gameta koja se redovito razlikuje od muške po tome što je veća i nepokretna. progesteron). Ime je dobio po svom nalazištu. dio je probavila.To su jedini sisavci koji nesu jaja i imaju nečisnicu koja se otvara van jednim otvorom (ime!). čvrste građe. JAVANSKI PRAČOVJEK (pitekantropus). Nemaju sekundarni rast u debljinu. Žive u Australiji. otoku Javi. Z. imaju i endokrinu ulogu odnosno lučenje ženskih spolnih hormona (estrogen. ali i neke stanične organele: lizosome i endoplazmatsku mrežicu. Nalazimo je i u biljaka i životinja. Iz mliječnih polja na trbuhu izlazi mlijeko koje mladi ližu. razne vrste luka). Embrio lateralno (postrance) smješten u sjemenci. JAJNICI (ovariji). Progutana hrana putuje prema želucu. JANSSEN. jaje). U žena su to parni organi koji leže s lijeve i s desne strane trbušne šupljine.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE J JAJAŠCE. Osobine jednosupnica Jedna supka u sjemenci. u odraslih žena veličine badema mase između 10 i 20 g. ženski spolni organi ili žlijezde višestaničnih životinja u kojima se razvijaju ženske spolne stanice. Građena je od proteina i lipida pa se naziva i lipoproteinska ovojnica. JEDNOSTAVNI ŠEĆERI.

KAPLAN. vrste koje su tamo zastupane s velikim postotkom stalnosti. glomerul. 64 . KALUS. v. nalazi se između kore i drva stabljike. pretvara ih jedne u druge.5 kg. tvar što izaziva nastanak raka. kod biljaka pojava dizanja vode u kapilari. stanična struktura koja se nalazi unutar jezgre. kalorimetrijska bomba. ovojnicom. skupina nediferenciranih stanica u biljaka koja nastaje pri ozljedama zeljastih i drvenastih biljaka. sprava kojom se mjeri energetska vrijednost hrane tzv. proteinska ovojnica nukleinske kiseline kod virusa. uništava. v. koji se opušta kako bi propustio hranu u želudac odnosno steže da bi spriječio povrat hrane u jednjak. KANCEROGEN (karcinogen). Jetra je ključni organ metabolizma i probave u organizmu. U vrijeme diobe stanice (profaza mitoze. Kambij omogućuje rast stabljike u debljinu i sudjeluje u formiranju provodnih tkiva (floema i ksilema). One ne moraju biti i dominantne vrste. JEZGRICA (nukleolus). KARAKTERISTIČNE VRSTE u biocenozi. KAPILARNOST. dok se jezgrica i jezgrina ovojnica razgrađuju i gube.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ njem mišićne stijenke. a ti proteini određuju sve strukture i funkcije u stanici. nukleus. Izgrađuje. JEZGRA (stanična jezgra. inaktivira i izlučuje štetne i nepotrebne tvari. masti i bjelančevine. R. ali ima i niz drugih uloga. K KALORIMETAR. Toplina koja se oslobađa spaljivanjem uzorka hrane preračunava se u Joule . Na početku želuca nalazi se prstenasti – kardijalni mišić (sfinkter). ali je malobrojna pa nije dominantna. razgrađuje i pohranjuje ugljikohidrate. jezgru nalazimo u svim stanicama osim u crvenim krvnim stanicama ili eritrocitima.. jedna ili više jezgrica i svi su skupa obavijeni jednom dvostrukom membranom. KAMBIJ. Takav način zarašćivanja rana kalusom bitan je u postupcima cijepljenja biljaka. U njoj se sintetiziraju ribosomska ribonukleinska kiselina (rRNA). JUŽNI PRAČOVJEK. profaza I i II) u jezgri nastaju posebne strukture – kromosomi. JEJUNUM. tj. Za vrijeme interfaze ili razdoblja između dvije diobe stanice u jezgri se nalazi: kromatin. v. vrsta tvornog staničja u drvenastih biljaka. Osušeni (dehidrirani) uzorak usitnjene hrane spaljuje se uz prisutnost kisika (oksidira) do pepela. KAPILARNO KLUPKO BUBREGA. izlučuje žuč. najveća žlijezda u tijelu. tanko crijevo. Neke se stanice kalusa diferenciraju i izgrade ono tkivo koje je oštećeno ozljedom. peristaltikom. reakcije u tami. stvara činitelje zgrušavanja. KAPSIDA. Omogućena je svojstvima molekula vode: kohezije i adhezije. KALVINOV CIKLUS. karion). jezgrin sok. Teška je oko 1. v. JETRA. australopitekus. najveći i najvažniji stanični organel eukariotskih stanica jer sadrži informaciju za sintezu proteina stanice. proizvodi globuline pa igra važnu ulogu u obrambenom sustavu organizma. objavio matematički dokaz abiotičkog nastanka prvih organizama. U čovjeka. Planinska je ševa karakteristična u planinskim travnjacima.J (džule) osnovne jedinice za energiju.

stanica u stvari pohranjuje višak energije koji se javlja u procesima staničnog disanja. KARCINOGEN. U vrijeme karbona pojavljuju se prve golosjemenjače. KARIOKINEZA. KARBON (lat. v. jegulje. započeo je otprilike prije 275 milijuna godina i trajao je 50 milijuna godina. npr. ugljeno doba. skup kemijskih i biokemijskih procesa razgradnje većih molekula u manje jedinice. 10. jezgra. KARIOTIP. drugi naziv za mesojede. 14 i 15 D skupini. podjela jezgre u vrijeme diobe stanice (mitoze. a radi mriještenja zalaze u more. kemijska reakcija ubrzana utjecajem (bio)katalizatora (enzima). KARNIVORI. 8. KARION. 11 i 12 C skupini. S druge strane. v. a 21 i 22 G skupini. 9. a 1 par čine spolni kromosomi. To je npr: rosika. organizmi koji energiju potrebnu za život dobivaju od kemijskih reakcija. podjeli citoplazme. selidbe riba. KEMIJSKA ENERGIJA. 7. mejoze) koja prethodi citokinezi. isp. stapanje muške i ženske jezgre u jednu jezgru. jedno od geoloških razdoblja nazvano po bogatim naslagama ugljena. posebno drvenastih papratnjača od kojih je i nastala najveća količina kamenog ugljena.kancerogen. kod gljiva. KARBAAMINOHEMOGLOBIN.2 i 3 pripadaju A skupini. Žive na siromašnim tlima. KATALAZA. Stanica do te energije dolazi razgradnjom energetski bogatih organskih spojeva u procesu staničnog disanja. U svim tjelesnim stanicama čovjeka nalazi se potpuna kromosomska garnitura (diploidna garnitura) od 46 kromosoma koji su prema dogovoru znanstvenika raspoređeni po obliku i veličini i označeni brojkama.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE KARAKTERISTIČNI FOSILI. 16. a od životinja prvi gmazovi. 4 i 5 B skupini. energija pohranjena u kemijskim vezama različitih kemijskih spojeva. carbo = ugljen). Sve te biljke imaju posebne žlijezde koje luče probavne enzime. 6. v. provodni fosili. 13. 19 i 20 F skupini. KATABOLIZAM. formirajući kemijske spojeve bogate energijom. oksidacijom anorgan- 65 . posebice dušik. KATADROMNE SELICE. molekula hemoglobina koja prenosi vezani ugljikov dioksid. KEMOAUTOTROFI. KARNIVORNE (mesojedne) BILJKE. Za sve životne aktivnosti i biljne i životinjske stanice potrebna je energija. v. KARBONIZACIJA. Kemijski procesi kojima se formiraju i kojima se razgrađuju energetski bogati spojevi su procesi oksidacije i redukcije. najčešće kukcima (kukcojedne ili insektivorne biljke) čijom probavom dobivaju potrebne mineralne tvari. pougljenjivanje. 17 i 18 E skupini. Upoznavanje kariotipa čovjeka pomoglo je znanstvenicima da otkriju mnoge genetski uvjetovane anomalije i bolesti. citološki prikaz potpune kromosomske garniture (svih kromosoma) pojedine stanice nekog organizma. enzim koji ubrzava razgradnju vodikovog peroksida. biljke koje se povremeno hrane sitnim životinjama. štetnog spoja koji nastaje u stanici prilikom metabolizma masti. Autosomi ili nespolni kromosomi raspoređeni su prema sličnosti u 22 para. U vrijeme karbona vlažna i topla klima omogućila je razvoj biljnog svijeta. ribe koje žive u slatkoj vodi. KATALIZA. Parovi autosoma grupiraju se u 7 skupina na taj način da parovi 1. KARIOGAMIJA.

citostatici. Kisele kiše djeluju štetno na sve ekosustave. To se područje aktivira porastom razine ugljikovog dioksida u krvi i šalje preko inspiracijskog središta dopunske impulse prema dišnim mišićima. dio sjemenke koji se razvija nizom mitoza iz oplođene jajne stanice (zigote). Kitovi se dijele na zubane i usane. KINETODEZMA. sumpornih spojeva. KITOVI. pelikula. željezovih iona. pelikula. Ta je svestrana bjelančevina lagana. KISELE KIŠE. soma = tijelo). taksija. nitrificirajuće bakterije. jedan od izumrlih oblika čovjekovih predaka koji se smatra pripadnikom vrste uspravnog čovjeka (Homo erectus). KINETIČKI APARAT. padaline koje su zakiseljene zagađivačima atmosfere: sumpornim dioksidom. KEMOSENZITIVNO PODRUČJE. KEMOTERAPIJA. Prednji su se udovi preobrazili u peraje. tropizmi KERATIN. v. pupoljka i supki. KEROGEN. KIŠNA ALGA. Kini. Najveće količine kisika potječu od velikog broja fitoplanktonskih organizama mora i oceana. Iz tih će se dijelova klijanjem formirati mlada biljka. netopljive organske tvari koje nastaju u stijenama u obliku kemofosila. pleistocena. KINESKI PRAČOVJEK (sinantropus). dopunsko respiracijsko središte koje se nalazi u produženoj moždini i djeluje na inspiracijsko središte. o oslobađa se procesom fotosinteze. pelikula. KLIMAKTERIJ. KLICA (embrio). strukturalna bjelančevina koja izgrađuje npr. pliskavica. penicilijum. Smatra se da je sav kisik u atmosferi nastao kao rezultat fotosintetske aktivnosti zelenih biljaka. KEMOFOSILI. Stijenka spore gljive sluznjače također je od keratina. Naziv je dobio po nalazištu. O2. U mu- 66 . v. nokte i perje. Pripadaju najvećim životinjama u biosferi. ugljikovim dioksidom i ugljikovim monoksidom. Ti se plinovi otapaju u vodi kiša i pod utjecejem Sunčeva svjetla i atmosferskog kisika nastaju kiseline. KEMONASTIJE. v. KEMOTAKSIJE. kemijski element. v. Ispod kože imaju debeli sloj masnoće. KEMOTROPIZAM. poznavao je vatru i koristio primitivno kameno oruđe. mangana i dr. Kitovi zubani se hrane ribom i drugim životinjama. kosu. KISTAC. kinein = pokretati. Volumen mozga iznosio mu je oko 1000 cm3. zelene alge. elementarni sastav). razdoblje u životu čovjeka u kojem se događaju različite fiziološke i psihičke promjene koje su rezultat hormonskih promjena u organizmu. v. npr. Kitovi usani filtriraju vodu kroz usi (rožnate ploče) i hrane se planktonom. Poznatiji su: ulješura. Kemoautotrofni organizmi su prokarioti. najstariji oblik fosila kemijskog podrijetla. Zrela klica sastoji se od korijenka. zelene alge.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ skih tvari: amonijaka. neophodan za život svih organizama (isp. v. U ranom stadiju klica ima oblik kugle. KLAMIDOMONAS. nastije. isp. delfin i plavetni kit. KISIK. savitljiva i jaka. Starost nalaza iznosi 300 do 500 tisuća godina što znači da datira iz perioda srednjeg kvartara. dušikovim oksidom. Rađaju žive mlade koji sišu. v. v. skupina sisavaca prilagođenih životu u moru. v. KINETOSOM (grč. Udišu kisik iz zraka. Organizmi ga troše u procesu disanja. Zameci imaju dlačice koje se kod odraslih izgube. v.

KLJEŠTARI. nepravilni menstruacijski ciklusi te njihov konačan izostanak. stanični organel. KLOROFIL. luče ju obložne stanice u sluznici želuca podražene progutanom hranom. grinje. njemački bakteriolog koji je identificirao bacil koji uzrokuje tuberkulozu. nastalih nespolnim i vegetativnim razmnožavanjem te partenogenezom i apomiksijom. supstrati i enzimi koji su potrebni za odvijanje fotosinteze. KLOAKA. a mogu se dijeliti neovisno o diobi stanice. umor i tjeskoba.. tj. Pripadaju im paučnjaci: pauci. Plijen savladavaju otrovnim žlijezdama. KOACERVATI. v.tilakoide. životinje iz skupine člankonožaca. Uz usta imaju kliješta ili helicere. kodon KODOMINANTNOST. Mjesta gdje su te membrane gusto raspoređene u više ili manje visoke stupce zovu se grana-tilakoide. Nemaju ticala. KOD. zajedničku dominan- 67 . Isp. žarne stanice. a zatim ga isisavaju. Tijelo je podijeljeno na glavopršnjak (prosoma) i zadak (opistoma). a unutarnjost mu je ispunjena otopinom koja se zove stroma. (1843. Obavijen je dvostrukom membranom. Kloroplasti i mitohondriji su specifični stanični organeli po tome što sadrže vlastitu DNA i vlastite ribosome. – 1910. Kiselina je važna za aktiviranje pepsina. KLONIRANJE. status kada oba alela istoga gena u heterozigotu daju jednaku izražajnost. napadaji vrućine. navažniji biljni pigment za apsorpciju svjetlosne energije u procesu fotosinteze. a mjesta gdje su rjeđe raspoređene zovu se stromatilakoide. autonomnim parasimpatičkim živčanim sustavom (i živac vagus) te probavnim hormonom gastrinom. Sintetizirao ih je ruski biokemičar Oparin prikazavši time jedan od mogućih stupnjeva evolucije žive tvari. R. Imaju sposobnost rasta i izmjenjivanja tvari s okolišem pa time pokazuju sličnosti s protoplazmom. nečisnica. v. v. Postoje klorofili a i b. svojta. Nalazi se samo u biljnim stanicama eukariota. ribosomi. pripada skupini organela (plastida) koji sadrže pigmente. Zelene su boje. Zajedno s Pasteurom smatra se osnivačem eksperimentalne bakteriologije. kemijski spoj. U membranama tilakoida nalaze se molekule klorofila. Većina ih živi na kopnu. v. KLOROPLAST.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE škaraca započinje obično između pedesete i šezdesete godine života smanjenjem lučenja hormona testosterona zbog čega se postupno smanjuje i spermatogeneza. pigmenta koji je neophodan za odvijanje fotosinteze. KOCH. proizvodnja klonova. U žena se obično javlja u dobi od četrdeset i pete do pedesete godine života. KLORIDNA KISELINA (HCl). isp. KLJUNAŠI. KNIDOCITI. RNA. štipavci ili škorpioni i dr. KLON. a karakterizira ga smanjeno lučenje hormona estrogena i progesterona. koloidne kapljice s opnama koje nastaju ako se određeni organski spojevi otapaju u vodi uz dodatak različitih soli. jednootvori. Probavu počinju izvan organizma ispuštanjem probavnih sokova u plijen. skupina genetički jednakih stanica ili organizama nastalih mitozom od jedne stanice ili zajedničkog podrijetla tj. KLITELUM. U stromi se nalaze: DNA. isp. v.). Unutarnjost kloroplasta je po- dijeljena membranama na plosnate vrećice . isp. razdražljivost. maločetinaši. U stanici se nalazi uz druge pigmente u grana tilakoidnim membranama kloroplasta.

genetička uputa). Nadmetanje je često i među jedinkama različitih vrsta (interspecijska kompeticija). nukleinskih kiselina. u grozdastim nakupinama (stafilokoki) i dr. KOLESTEROL. Morski su kolutićavci razdvojena spola i razvijaju se preko ličinke trohofora. KOKON. v. KOMPLEMENTARNE BAZE. te protiskuje nakupljenu žuč žučnim vodovima u dvanaesnik. probavni hormon koji se luči iz stanica sluznice dvanaesnika kada je prisutna masna hrana u dvanaesniku. KOLECISTOKININ. Hormon se apsorbira iz crijeva u krv. u paru (diplokoki). v. pločaste ili kuglaste. Tijelo im je ravnomjerno kolutićavo. a kopneni (gujavica) površinom vlažne kože. Nalazi se u membranama životinjskih stanica. Prema tjelesnoj građi dijele se u tri skupine: mnogočetinaši. Slatkovodni i kopneni kolitićavci su dvospolci. filogenetski sustav. v. npr. Vodeni kolutićavci dišu pomoću škrga. KODON (kod). Pokreću se stezanjem prstenastih i uzdužnih mišića. KOLENHIM. hipoteze o postanku mnogostaničnih životinja. Međusobna privlačnost molekula vode je važna za uzlazni tok vode u biljci. životnim skloništem ili/i spolnim partnerom. Optjecajni sustav je zatvoren.maločetinaši i paučnjaci. simbioza. v. KOLJENO. privlačna sila između molekula ili atoma iste tvari. slijed triju nukleotida na molekuli mRNA koji određuje položaj određene aminokiseline pri sintezi proteina (isp. KOLOIDNE OTOPINE. KOMENZALIZAM. Takve čestice nazivamo koloidnim česticama. u živčanom tkivu i krvnoj plazmi. Značajan je i kao ishodišna molekula u sintezi nekih hormona. Neke od ovih bakterija uzročnici su teških bolesti. Živčani sustav je ljestvičav. potporno staničje. itd. u nizovima (streptokoki). nakupine jednostaničnih organizama među kojima nema podjele rada.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tnost. krvlju dospijeva do jetre odnosno žučnog mjehura koji se pod utjecajem kolecistokinina steže. KOKI. suparništvo u istom okolišu među prekobrojnim jedinkama za hranom. otopine koje sadrže otopljene tvari čiji je promjer čestica između 1 i 100 nm. a manje u kopnenim vodama ili na vlažnim staništima. Najviše ih živi u moru. KOMPETICIJA (nadmetanje). KOLONIJALNA TEORIJA O POSTANKU METAZOA. Stanična otopina je koloidna otopina čije su koloidne čestice molekule proteina. Dipolarne molekule vode su povezane slabim vodikovim vezama. već svaka stanica samostalno obavlja sve životne funkcije. KOLUTIĆAVCI (Annelida). Dolaze pojedinačno (monokoki). Kompeticija je najjači biotički čimbenik unutar jedinki iste vrste (intraspecijska kompeticija).). Za izlučivanje imaju po jedan par metanefridija u svakom kolutiću. U krvi se nalazi hemoglobin. Nasuprot jedne purinske baze iz jednog polinukleotidnog lanca dolazi pirimidinska baza drugog polinukleotidnog lanca. U svakom se kolutiću ponavljaju isti organi. krvnu grupu AB određuju aleli A + B. KOLONIJA. Na površini je kutikula i jednoslojni epiderm bogat žljezdanim i osjetnim stanicama. bezkralješnjaci iz skupine mnogokolutićavaca. v. bakterije kuglastog oblika. Tako nasu- 68 . odgovarajuće dušične baze koje u molekuli DNA dolaze uvijek jedna nasuprot drugoj. KOHEZIJA. Oblikom mogu biti nitaste. maločetinaši i pijavice. organski spoj iz skupine steroida (isp.

Jedna od dioba je mejotička. pojava kada pripadnici različitih skupina organizama u evoluciji steknu slične specijalne prilagodbe za život u određenim uvjetima. očuvali u jantaru. U pustinjskoj su se klimi organizmi isušivali i mumificirali. a druga nepokretna ili stacionarna.) hrane u prirodi. ali se pri tome u molekulu RNA umjesto timina uvijek ugrađuje uracil. KONZUMENTI. životinje. Od 2 haploidne jezgrice koje su ostale jedna je pokretna ili migrirajuća jezgrica. Migrirajući mikronukleus iz svakog konjuganta preko citoplazmatskog mosta prelazi u suprotnu jedinku. Nakon Komplementarne baze Purinske adenin gvanin Pirimidinske timin citozin Simbol A-T G-C Pojednostavljeni prikaz sinteze RNA prema kalupu jednog lanca DNA: Komplementarne baze Purinske adenin gvanin Pirimidinske uracil citozin Simbol A-U G-C KOMPOSTIRANJE. Po principu komplementarnosti sintetizira se i molekula RNA na matičnoj polumolekuli (jednom lancu) DNA. KONTRAKTILNA VAKUOLA. KONJUGACIJA (lat. U ledu i smrznutoj zemlji (Sibir. primjerice kukci. proizvodnja komposta iz organskog otpada truljenjem uz pomoć bakterija razlagača. Manji su se organizmi. Spoji se sa stacionarnom jezgrom u zigotu. trepetljikaši). ribe i pliskavica. smrzavanjem ili čuvanjem u smoli. Aljaska) nađeni su ostaci mamuta. coniunctio = spajanje). kao npr. Od svih 8 nastalih mikronukleusa ostaju samo 2. proces nastajanja fosila isušivanjem. conservatio = čuvanje). U svakoj se jedinki mikronukleus podijeli 3 puta. Taj se proces naziva prepisivanje (transkripcija) DNA u RNA. isp. penicilijum. upavši u smolu crnogorice koja se skrutnula. KONVERGENTNA EVOLUCIJA. a nasuprot gvanina citozin i time čine komplementarne parove AT i GC. pojava morfološke sličnosti filogenetski. 69 . Proces konjugacije započinje spajanjem dvije jedinke i stvaranjem citoplazmatskog mostića. tj. drugi se razgrade i nestaju. alga i praživotinja (v. Tako se između dvije jedinke izmijeni nasljedna tvar. v. izmjena genetičkog materijala sadržanog u mikronukleusu. KONZERVIRANJE (lat.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE prot adenina uvijek stoji timin. način “spolnog razmnožavanja” u nekih bakterija. tj. stežljivi mjehurić. srodstveno udaljenih grupa organizama. KONVERGENCIJA. v. Tako spojene jedinke nazivaju se konjuganti. konvergentna evolucija. potrošači (isp. KONIDIOSPORE.

sir. U Jadranskom moru poznati su crveni koralj. Iznosi približno 0. KORIJEN. Na površini protoplazme izlučuju ljušturicu od vapnenca ili silicija. Srednji je prst najjači i nosi masu čitavog tijela. Poznati su numulitski vapnenci nastali taloženjem ljušturica krednjaka numulita. rakovi). Pojavljuje se kao mali crvenkasti otoci na koži koji svrbe. sloj obamrlih stanica omogućujući tako prodor korijena i u tvrda tla. konj. ali može biti izazvana i fizičkim faktorima. Razlikujemo: pravi korijen koji se razvija iz klicinog korijenka. U zubalu nemaju gornjih sjekutića ni očnjaka.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ toga se jedinke razdvoje i tada se nazivaju egzokonjuganti. Obično hodaju na 2 prsta: treći i četvrti su veći od ostalih i nose čitavo tijelo. KORALJI. KORIJENOVA KAPA. sunašca i zrakaši. antilope. Većina ih živi u moru: krednjaci. Većina ima čvrsti vanjski i unutarnji kostur od kalcijeva karbonata. magarac. crvena moruzgva i smeđa vlasulja. tj. Temelji se na procesu aktivnog izlučivanja vode i tvari stanica endoderma u provodne žile ksilema. Poznatiji su npr.atole. Na nogama imaju 1 ili 3 prsta obložena rožnatim kopitom. KOPITARI NEPARNOPRSTAŠI. Odumiranjem organizama ljušturice se talože na morsko dno tvoreći debele naslage. opskrbljuje biljku vodom i mineralima koje upija korijenovim dlačicama. korijen. KORIJENSKI GOMOLJIĆI (noduli). (urtikarija). kožno staničje odrvenjelih biljnih organa. Amoeba proteus. Preživači žive u stadima. žirafe. KORJENONOŠCI (sluzavci). konjugacija. KORIJENOV TLAK (tlak korijena). KORA. Nježno tvorno staničje štiti korijenova kapa. ovce. Površinu tijela pokriva joj dvoslojna lipoproteinska stanična membrana. Žive u morima. hladnoćom i toplinom kao i ujedima i ubodima insekata. višegodišnje stabljike i višegodišnjeg korijena. biljojedi iz skupine sisavaca. Stvaraju koraljne grebene i otoke . jeleni. Dijele se na nepreživače (svinje i vodenkonji) i preživače (deve. Kopita su građena od keratina. v. jagode. pojedinačno ili u zadrugama. npr. jedan od tri temeljna organa kopnenih biljaka. KOPRIVNJAČA. koze. životinje iz skupine žarnjaka. pozitivan hidrostatski tlak koji vodu iz korijena tjera prema gore. U kopnenim vodama živi ameba. praživotinje koje se kreću uz pomoć pseudopodija. Hranu može uzimati cijelom površinom 70 . Učvršćuje izdanak. svitkoglavci. do otprilike 1 m. oblik alergijske reakcije koji se javlja kao preosjetljivost na neke vrste hrane (maline. čupavo (pridošlo.1 MPa i važan je za dizanje vode u biljci. Želudac im je prilagođen na preživanje. Građeni su od biljnih stanica u kojima se nalaze simbiotske dušikove bakterije (u obliku bakteroida) koje obavljaju fiksaciju dušika iz zraka. v. a imaju ga sve golosjemenjače i dvosupnice. Mnogi imaju rogovlje. sve biljke koje rastu i u debljinu. adventivno) korijenje u papratnjača i jednosupnica izrasta naknadno jer njihov korijen ubrzo propada zbog nemogućnosti rasta u debljinu. zebra i nosorog. KONJUGANTI. npr. nabreknuća (kvržice) na korijenu mahunarki. Svi su polipi. KOPLJAČA. posebno u proljeće prije listanja. KOPITARI PARNOPRSTAŠI (papkari). bivoli). Raste u dužinu uz pomoć tvornog staničja na svome vrhu. veliki biljojedi iz skupine sisavaca. v.

Rast kostiju omogućuju koštane stanice – osteoblasti. Nametničke amebe žive u unutarnjim organima životinja i čovjeka. Najrazvijeniji je mišić za uvlačenje glave. KORNJAČE. Kod vrsta koje žive u vodi noge su se modificirale u peraje. žutu i želatinoznu moždinu. U kostima se nalaze i stanice koje razgrađuju koštanu tvar . srdoboljna ameba. v. najčvršći dio kostura. hormoni koje izlučuje kora nadbubrežne žlijezde. isp. One nemaju korijen. krvotok srčanog mišića. stanice ovalnog oblika koje izgrađuju koštano 71 . Sastoji se od kosti. nego su im čeljusti pokrivene rožnatim pločicama. Kosti sadržavaju oko 70 posto anorganskih tvari (kalcija. KOŠTANA MOŽDINA. Izlučivanje kortikosteroida je pod kontrolom adenokortikotropnih hormona (ACTH) iz adenohipofize. procesom endocitoze.osteoklasti. Osnovna jedinica je osteon. a danas im pripadaju papratnjače i sjemenjače. KORTIZON (kortizol). a u Jadranu je česta glavata želva.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tijela. Disanje je aerobno. Izvana je obavijena pokosnicom (periost). a plinovi prolaze procesom difuzije kroz membranu. KOŠTANE STANICE (osteociti). Među stablašicama posebno mjesto imaju i mahovine koje osim obilježja stablašica nose i obilježja steljnjača ili Talophyta. kao npr. Najznačajniji kortikosteroidi su glukokortikoidi (kortizon. kortikosteron) koji reguliraju promet ugljikohidrata i mineralokortikoidi (aldosteron) koji reuguliraju promet iona u organizmu. stablo). isp. srčane arterije. U ustima nemaju zube. U uhu imaju bubnjić. dajući oslonac mišićima. potporanj tijela koji mu daje čvrstoću. kao npr. a ženke izlaze na kopno samo da izlegu jaja. skupina gmazova s oklopom na kojem se nalaze otvori za noge i glavu. Kostur čovjeka ima oko 208 kostiju. hrskavice i ligamenata. niti su im u potpunosti razvijeni stabljika i listovi. stabljiku i list. Danas živi oko 250 vrsta. megakariociti (trombociti) i leukociti granulociti. KORONARNE ARTERIJE. taloženje masnih naslaga (aterona) u koronarnim arterijama što smanjuje protok krvi pa je srčani mišić slabije opskrbljen kisikom i hranidbenim tvarima. Razlikujemo crvenu.) i oko 30 posto organskih tvari (osein). glukokortikoidni hormon koji se oslobađa u stresu pospješujući opći metabolizam. oblik i omogućuje kretanje. KORONARNA SKLEROZA. Egzoskelet i zaštićuje organizam. biljno tijelo koje ima razvijene osnovne prehrambene (vegetativne) organe: korijen. tkivo koje ispunjava moždinsku šupljinu kosti i prostore među gredicama spužvastog koštanog tkiva. KOSTUR. kortikosteroidi. Na dugim kostima razlikujemo dva kraja ili epifize i srednji dio dijafizu koja je ispunjena do spolne zrelosti crvenom koštanom moždinom. Oklop je nastao stapanjem kožnog i unutarnjeg kostura. Sve biljke s razvijenim kormusom zovemo stablašice ili Cormophyta. KORMUS (cormus. Poznatije kornjače naših krajeva: barska kornjača. fosfora i dr. Razmnožava se običnim dvojnim ili binarnim dijeljenjem. Suvišnu tekućinu izbacuje pomoću stežljivih mjehurića (kontraktilne vakuole). U crvenoj moždini nastaju eritrociti. Nakon spolne zrelosti koštana moždina se u dugim kostima zamjenjuje masnim tkivom. obična čančara u Dalmaciji i na otocima. Građena je od koštanog tkiva: vanjskog kompaktnog i središnjeg spužvastog sloja. kod mekušaca i člankonožaca. KORTIKOSTEROIDI (kortikosteroidni hormoni). Razlikujemo vanjski (egzoskelet) i unutarnji (endoskelet) kostur. Kralježnjaci imaju endoskelet. KOST.

pousminu ili epidermu i unutarnji dio. zubatac. vrsta epitelnog ili pokrovnog tkiva. glavni potporanj tijela svih kralježnjaka. usminu ili dermu. list i dr. Važna je u održavanju stalne tjelesne temperature kod homeotermnih životinja. gmazove. Koža kralježnjaka građena je od više slojeva koji izgrađuju površinski dio. KOŽA. krvne i limfne žile. Formira se u tijeku embrionalnog razvoja kralježnjaka oko svitka. štuka. oslić. Pripada tipu neandertalskog pračovjeka koji se danas smatra samo jednom od izumrlih vrsta umnog čovjeka (Homo sapiens). Poznatije su koštunjače u kopnenim vodama: šaran. – 1981. u gmazova je pokrivena ljuskama ili pločama. srdela. kovač. moždinski živci. grgeč. različita osjetilna tjelešca. a omogućuje izmjenu plinova između biljke i okoliša. H. skupina životinja čije tijelo podupire kralježnica. te se zrake svjetla pri akomodaciji oka na daleke predmete lome već ispred mrežnice. (1900. Potkoljeno kralježnjaka sadrži oko 40000 vrsta. Tri su vrste kožnog staničja: epiderma. KOTILEDONI. Prvi kralježnjaci pojavili su se početkom paleozoika. KRALJEŽNICA (columna vertebralis). KRALJEŽNJACI (Vertebrata). Nemaju zavojiti zalistak u crijevu. u staklovini. Imaju plivaći mjehur. hranio se mesom divljih životinja. bavio se lovom. Pripadaju lubanjcima iz koljena svitkovci. Može sadržavati žlijezde znojnice i lojnice. u ptica perjem. u izmjeni plinova i dr. KREBSOV CIKLUS (ciklus limunske kiseline). ali ima vrsta i s golom kožom. KOŽNO STANIČJE. najbrojnija skupina riba (isp. njemački biokemičar. Bio je relativno niskog rasta (do 160 cm) s jakim nadočnim lukovima i izbočenim čeljustima bez izrazite brade. poremećaj vida u kojem je očna jabučica izdužena. Kratkovidnost se ispravlja konkavnim lećama (negativna dioptrija). U riba je pokrivena ljuskama. KOŠTUNJAČE. najčešće kalcijev fosfat i kalcijev karbonat) dijela. klen.). Izlučuju krutu međustaničnu tvar koja se sastoji od organskog (protein osein) i anorganskog (minerali. KRATKOVIDNOST (miopija). a nastaje od zametnog listića mezoderma kao i sve ostale kosti. pastrva. v. ptice i sisavce. rizoderma i kora. Od morskih riba u Jadranu žive: skuša. u vodozemaca je gola. a u sisavaca dlakom. Škrge su pokrivene škržnim poklopcem. Na mrežnicu pada neoštra slika. protumačio ciklus limunske kiseline koji je nazvan i Krebsov ciklus. KRALJEŽNIČKI ŽIVCI. Oplodnja je vanjska. list. ima prije svega zaštitnu ulogu. u primanju vanjskih podražaja pomoću osjetilnih tjelešaca. Razmnožavaju se jajima. Rasprostranjeni su u vodi i na kopnu. ribe. KREBS. a koristio je kameno oruđe i vatru. Starost tih nalaza procjenjuje se na 70 tisuća godina. jedna od aerobnih faza stanične 72 . ogranke živaca i masne stanice. izumrli čovjekov predak čiji su nalazi pronađeni u jednoj poluspilji u Krapini (Hrvatsko Zagorje). Dijele se na kružnouste.). som. isp. vodozemce.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tkivo. Živio je u većim skupinama. v. Ljuske na koži su okruglaste (cikloidne) i češljaste (ktenoidne). Njena osnovna uloga je zaštititi organizam od negativnih učinaka okoliša. sastavljen od većeg broja kralježaka. Imaju koštani kostur. KRAPINSKI PRAČOVJEK. u odstranjivanju štetnih produkata tvarne izmjene iz tijela. organ koji pokriva vanjsku površinu tijela čovjeka i životinja.

za njega potrebna i korisna svojstva. Masivno tijelo nose kratke noge. potomak nastao križanjem (hibridizacijom). v. proces miješanja nasljeđa dvaju različitih roditelja. v. dvodijelnom. odakle se dva mjeseca prije rođenja spuste u mošnju djelovanjem fetalnog testosterona. Žive u vodama tropskog i suptropskog pojasa. KROKODILI. Čovjek primjenjuje umjetno križanje da bi dobio potomke koji imaju neka. već ga komadaju snažnim zubima smještenim u jako izbočenoj njušci. leptiri. nakaznici. komarci. KRILAŠI. vodencvjetovi. zaštitna obojenost. U prošlosti su sudjelovale u izgradnji naslaga zemlje koja se zove dijatomejska ili kremena zemlja. v. KRIŽANJE (hibridizacija). biljke kratkog dana i biljke dugog dana KRITOSJEMENJAČE. obadi). jelenci. KRITIČNO RAZDOBLJE TAME. minimalno razdoblje tame koje zahtijevaju biljke kratkog dana da bi mogle cvjetati. Ima osobine oba genetički različita roditelja (isp. Poznatije 73 . ose i pčele. Ne mogu gutati plijen.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE respiracije ili staničnog disanja koja se odvija u mitohondrijima. najrazvijeniji i najveći živi gmazovi. Poznatije su skupine: vretenca (vilin konjic). dvokrilci (muhe. termiti). kremenjašice. Plodnica se razvija u cvijetu kao dio tučka. Koža je pokrivena velikim rožnatim pločama. bilo prirodnim bilo umjetnim putem. Cvijet. KREMENA ZEMLJA. Sjemenici nastaju u trbušnoj šupljini. mravi. potkornjaci). Prilagođene su životu na svim područjima na Zemlji. Zadružni kukci su: mravi. nikada škrob. isp. prirođena mana da se sjemenici ne nalaze u mošnjama. termiti. heterozigot). tekuti). božje ovčice. U oko 5 % muške djece jedan se testis (rjeđe oba) zadržavaju u trbušnoj šupljini. strizibube. Sjemeni su zameci zatvoreni ("sakriveni") u plodnici. Sjemenici koji zaostanu najčešće zakržljaju. korjenonošci. Cvjetanje je prvenstveno određeno trajanjem razdoblja tame. Veliki značaj imaju u primarnoj produkciji hrane. obolčari). ravnokrilci (skakavci. v. šturci. buhe. Prema broju supki razlikujemo jednosupnice i dvosupnice. KREDNJACI. žoharaši (bogomoljke. kornjaši (hruštevi. Poznato je više od 250 000 vrsta. jednostanične alge s čvrstom. U biljnom svijetu križaju se različite sorte biljaka. Produkti fotosinteze su masna ulja i poneki polisaharid. plodnica i plod su generativni organi svojstveni kritosjemenjačama. žohari. Razvijena je briga za potomstvo. grizlice (uši. KREMENE BILJKE. Napredak se očituje u građi srca gdje je klijetka gotovo potpuno podijeljena na desnu i lijevu stranu. Svi su krokodili grabežljivci. Naziva se ciklusom jer se sastoji od kružne serije biokemijskih reakcija u kojima se pirogrožđana kiselina razlaže na molekule ugljik(IV)-oksida i atome vodika pri čemu se oslobodi energija za sintezu ATP-a. pa se smanjuje rasplodna moć muškarca. bumbari). Krokodili su dugi do 6 m. evolucijski naprednije sjemenjače. pravilno struktuiranom stijenkom uglavnom (95 %) izgrađenom od kremena (SiO2). (hibrid). a u životinjskom različite pasmine. pčele. v. Žive na čvrstoj (vlažnoj) podlozi ili kao plankton slatkih voda i mora. KRIPTORHIZAM. a njihovi su preci živjeli na kopnu. KRIŽANAC. acidofilne biljke KREMENJAŠICE (Diatomeae). Obuhvaća oko 30 različitih skupina. opnokrilci (ose. skupina kukaca koji imaju 1 ili 2 para krila ili su im nestala tijekom evolucije. KRIPTIČNA OBOJENOST.

tj. Također se zamjećuju i jače obojena mjesta kromomere. DNA U vrijeme diobe stanice iz kromatina se formiraju posebne strukture. mrežica vlakana koju čine DNA i proteini. koja je dijelom ravna a dijelom namotana oko malih grudica bjelančevine (histona). v. eukromatin građen od vlakana rjeđe raspoređenih nego u heterokromatinu. Homo sapiens. posebne strukture koje postaju vidljive u jezgri eukariotskih stanica u vrijeme mejoze i mitoze. Izgrađena je od jedne molekule DNA i bjelančevina. Ne sadrže klorofil te nemaju sposobnost fotosinteze. KROMATIDA. KROMOSOMI S PETLJAMA. gangeski gavijal. heterokromatin koji je građen od gusto zbijenih vlakana i obično se raspoređuje uz jezgrinu ovojnicu. Sadrže biljna bojila. a nalazi se u jezgri eukariota u vrijeme interfaze. KROMATIN. Građeni su od DNA i bjelančevina. KROMOMERA. koje se nazivaju nukleosomi. Svaka vrsta ima spe- spojnice histona Građa kromosoma: DNA nit (kromonema) dijelom omotana oko nukleosoma KROMOSOMSKE KARTE. kromosom. v. šipak) i korijenu nekih biljaka (mrkva). stanični organeli. cjelokupna genetička informacija organizma. KROMANJONAC. kromosomi. misisipski aligator. polovica udvostručenog kromosoma.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ su vrste: nilski krokodil. genetičke karte. v. te utanjeno i neobojeno mjesto pričvrsnica (centromera). KROSINGOVER (crossing over). isp. kromatide konjugirani homologni kromosomi profaza I izmjena dijelova kromatida profaza I odvajanje kromosoma anafaza I 74 . žuta perunika i dr.). U njima su smješteni geni. Razlikujemo dva tipa kromatina: 1. pojava izmjene dijelova kromatida između dva homologna kromosoma. biljnim plodovima (rajčica. Glavni dio kromosoma je dvostruka nit (kromonema) sastavljena od molekula DNA. četkasti kromosomi. kromosom. KROMATSKA ADAPTACIJA. KROMONEMA. KROMOPLASTI. v. crvene karotene i žučkaste ksantofile. nukleosom (s 8 histonskih molekula) 2. mogućnost organizama da mijenjaju boju i tako koriste različite dijelove Sunčevog spektra. ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi. Kromoplasti daju boju mnogim cvjetovima (maćuhica. cifičan broj i građu kromosoma. v. obični kajman. KROMOSOMI.

kelj. Isp. a posebna skupina globulina. Razdvojena su spola. isp. nitrati itd. izvanstanična tekućina. skupina zeljastih biljaka dvosupnica čiji su mnogi pripadnici važne gospodarske biljke. pripadnici krvne skupine AB oba aglu- 75 . prijenosu hranjivih i drugih tvari (hormona. šest prašnika (četiri dulja i dva kraća) i plod suhi pucavac. Prve antigene otkrio je 1900.) što rade producenti. Ima važnu ulogu u izmjeni plinova. v. održanju količine vode u tijelu. Naš endem velebitska degenija je također krstašica. trombociti KRVNE SKUPINE. jedna od tjelesnih tekućina. tzv. KRVNA PLAZMA. Kao povrće rabe se npr. obrani tijela od infekcija itd. Žućkasta tekućina sastavljena od 90 % vode. Na hrskavičnoj lubanji nalaze se okrugla i lijevkasta usta sa rožnatim "zubićima" ili kvržicama. Bočna pruga im služi kao ravnotežni organ pri plivanju.krvne plazme i triju osnovnih skupina krvnih stanica: eritrocita. zajednički naziv za krvne stanice i krvne pločice ili trombocite. Krv se sastoji od tekućeg dijela . protječe kroz srčano-žilni sustav. KRSTAŠICE. nego ih konzumenti troše jedući biljnu hranu. tekuće vezivno tkivo. a značajan je jer doprinosi genetičkoj raznolikosti rasplodnih stanica (gameta) koje će nastati diobom (isp. γ-globulini ili imunoglobulini imaju važnu ulogu u obrani organizma protiv uzročnika bolesti. tekući dio krvi. Dijele se na paklare (imaju leđnu i repnu peraju) i sljepulje (imaju samo repnu peraju). podjela krvi prema bjelančevinama – antigenima koji se nalaze na membranama eritrocita. KRVNA TJELEŠCA. održavanju tjelesne temperature. cvjetača. Nazivaju se i bezčeljusti jer nemaju izgrađenih čeljusti. KRV. Paraziti su na ribama. i oogeneza i spermatogeneza). koraba i rotkva.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Crossing over se zbiva za vrijeme diobe stanice i to u profazi mejoze I. KRUŽNOUSTE (Cyclostomata). različiti kultivari kupusa: glavati kupus. vitamina itd). Korovna je biljka rusomača. Na temelju tih antigena utvrđen je AB0 sustav krvnih skupina u kojem se razlikuju 4 osnovne krvne skupine: A. AB i 0 (nula). dio krvi. Za izlučivanje imaju prvi bubreg. Fibrinogeni su važni u procesima zgrušavanja krvi. Krvna plazma sadrži tri vrste bjelančevina: albumine. Nešto kasnije otkrio je i prirodu tzv. KRVNE PLOČICE. Pripadnici krvne skupine A nose na membranama svojih eritrocita aglutinogen A. KRUŽENJE TVARI U PRIRODI počinje proizvodnjom hrane iz anorganskih tvari (H2O. B. tzv. Krvnu plazmu kojoj je odstranjen fibrinogen nazivamo krvni serum. CO2. izlučivanju štetnih tvari. Rh-faktora. Proizvedenu hranu ne koriste samo producenti za sebe. a za proizvodnju ulja uljena repica. Iz oplođenih se jaja razvija ličinka pokača. godine austrijski znanstvenik Karl Landsteiner i to A i B aglutinogene. globuline i fibrinogene. Svitak imaju cijeli život. Ukupni volumen krvi u odrasle osobe je oko 5 litara. leukocita i trombocita. najprimitivnija skupina kralježnjaka i najstariji lubanjci. 2 % anorganskih tvari (najviše iona natrija i klora) i 8 % organskih spojeva (najviše bjelančevina). pripadnici krvne skupine B aglutinogen B. U krvne stanice spadaju eritrociti ili crvene krvne stanice i leukociti ili bijele krvne stanice. Žive u moru ili kopnenim vodama. komušku ili komuščicu. Albumini i globulini sudjeluju u prijenosu hormona. Cvjetovi imaju četiri lapa i četiri unakrsne latice (ime!). I producente (biljke) i konzumente (životinje) i druge reducente nakon prestanka njihova života razlažu reducenti (gljive i bakterije) na anorganske tvari.

pripadnici krvne skupine 0 nemaju na svojim membranama eritrocita te aglutionogene. a pripadnik krvne skupine 0 ima i anti A i anti B (beta) aglutinine. Po obliku su lističave ili nitaste. filos = prijatelj). dio slezene i jetra. KSENOBIOTIK (grč. vrsta provodnog tkiva u biljaka čija je funkcija provođenje vode i mineralnih tvari iz korijena prema ostalim dijelovima biljke. xenos = stran). Limfopoeza je stvaranje limfocita. organi (škrge) za disanje kod većine mekušaca. Odvija se u limfnim čvorovima. U brojniku je sistolički. KRVOTVORNI (hematopoetski) ORGANI. koja je nepotrebna ili štetna za organizam. životinje sušnih područja. kaktusi. Tijelo je podijeljeno 76 . prehrane. najbrojnija skupina životinja. tj. Pripadnik krvne skupine B ima anti A (alfa) aglutinine. Normalni krvni tlak u velikim arterijama iznosi oko 16/10. Odvija se u slezeni i koštanoj moždini.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tinogena. timusu. Granulopoeza je stvaranje granulocita. KRVNI TLAK. KRVNI SERUM. kretanja i razmnožavanja. u slučaju transfuzije (davanja) krvi kada se ne slažu krvna skupina davatelja i primatelja. npr. strana tvar. Protok krvi kroz lijevu koronarnu arteriju odvija se u dijastoli. pripadnici pojedinih krvnih skupina sadrže u svojoj krvnoj plazmi i specifična antitijela koja se zovu aglutinini.To su: koštana moždina. pritisak krvi na stijenke krvnih žila. fyton = biljka). KUGA. Eritropoetski organi su organi s izrazitom proizvodnjom eritrocita. kao npr. a štetne tvari izlučuju u dehidriranoj formi (npr. Tako pripadnik krvne skupine A ima anti B aglutinine. tj. antitijela koja neće reagirati protiv vlastitih eritrocita. hrast crnika i medunac. xeros = suh. i dijelu slezene. sukulenti. Te arterije izlaze iz početnog dijela aorte i dovode srcu krv obogaćenu kisikom (oksigeniranu krv). KSEROFILNE ŽIVOTINJE (grč. KUKCI (Insecta). KSEROFITI (grč. poseban hranidbeni ili nutritivni krvotok miokarda tj. Krvni tlak izražavamo razlomkom. ne samo unutar člankonožaca. xeros = suh. isp. teška zarazna bolest uzrokovana bakterijama. pustinjski miš). organi specijalizirani u stvaranju pojedinih oblika krvnih stanica. pripadnik krvne skupine AB nema aglutinine. dok je protok kroz desnu koronarnu arteriju jednak u sistoli i dijastoli. Sastoji se od dvije male srčane arterije (lijeve i desne) i dvije male srčane vene (koronarne arterije i vene). protiv krvne skupine B. KTENIDIJE. biljke s organima prilagođenim za preživljavanje u sušnim ili pustinjskim uvjetima. a odgovorni su za reakciju aglutinacije (sljepljivanja) eritrocita što izaziva zdravstvene poteškoće pa i smrt. kukaca zaštićena je hitinom. a u nazivniku dijastolički tlak. Poznato oko 800 000 vrsta. Prilagođeni su na štednju vode smanjenim izlučivanjem. otrov ili toksikant. KRVOTOK SRČANOG MIŠIĆA. Dobro su prokrvljene. krvna plazma. Megakariociti su velike stanice koje nastaju u koštanoj moždini. Građen je od provodnih elemenata . Voda ih oplakuje a kisik difuzijom prelazi u kapilarni sustav i dalje se raznosi po tijelu. Mnogi sisavci nemaju žlijezde znojnice. a njihovim raspadanjem nastaju trombociti ili krvne pločice. srčanog mišića. v.7 kPa (stara mjera 120/80 mmHg). a gmazova rožnatim slojem. KSILEM. Površina tijela npr. Osim aglutinogena. ali će reagirati protiv eritrocita koji sadrže aglutinogen B.traheja ili traheida. Prilagođeni su na različite načine života.

muha ce-ce bolesti spavanja. metilja. KULTURA STANICA. toplinu. Dišu uzdušnicama koje se otvaraju parnim odušcima na zatku. v. Laktoza se sastoji od jedne molekule glukoze spojene s jednom molekulom galaktoze. tzv. 77 . kemijski spoj ugljikohidrat iz skupine disaharida. Ličinke se presvlače nekoliko puta i tada mogu rasti. v. Oko usta su 3 para usnih organa koja mogu biti za: grizenje (hrušt). Njima pripadaju ježevi. sluh. njuh. procesa u kojem se anaerobno razgrađuje šećer glukoza do alkohola etanola uz oslobađanje ugljikovog dioksida i energije: C6H12O6 ⎯⎯ ⎯ → 2C2H5OH + 2CO2 + ⎯ + energija Pivski ili pekarski kvasac (Sacharomyces cerevisiae) jedna je te ista vrsta koja također razgrađuje glukozu na etanol i ugljikov dioksid. rijetko askosporama. kultura tkiva. voštana prevlaka epidermalnih stanica koja zaštićuje biljku od prevelikog gubitka vlage. KVADRATNA KOST. Kod vodenih biljaka ne postoji. pa kukce i male životinje love uglavnom pomoću osjetila njuha. KUTIKULA (grč. Kod bezkralježnjaka vanjski rožnati. Razmnožavaju se pupanjem. Tijelo pokriva hitinska kutikula. Kod nepotpune preobrazbe nema stadija kukuljice. rakovi. plivanje ili skakanje). prsa i zadak. v. Vrsta vinski kvasac (Sacharomyces ellipsoideus) uzročnik je alkoholnog vrenja. Zvučne signale primaju pomoću timpanalnih organa. bodenje (komarac).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE na glavu. KVAŠČEVE GLJIVICE (saharomiceti). isp. buha kuge). Krv ne prenosi kisik. npr. Prsa čine 3 kolutića i nose 1 ili 2 para krila te 3 para nogu (za trčanje. deminutiv od kutis = koža). da ga ne razgrade probavni enzimi. kopanje. KULTIVAR. Neki spavaju zimski san. jednostanične gljivice mješinarke koje stvaraju kolonije u obliku razgranatih lanaca. skupina primitivnih kopnenih sisavaca s kratkim oštrim zubima. gušteri i zmije. lizanje (pčela). KUKCOJEDI. Postoje i kukci bez krila. Za izlučivanje imaju Malpighijeve cjevčice. Na leđnoj je strani žila koja čini srce. okus i vid. enzimi L LAKTOZA (mliječni šećer). Mnogi su nametnici i prenosnici uzročnika bolesti (komarac malaričar malarije. bjelančevinasti zaštitni sloj. uš pjegavog tifusa. Oči se sastoje od velikog broja okašaca. Ženke odlažu oplođena jaja na različita mjesta prema načinu života. U glavi je trodjelni mozak. Oplodnja je unutarnja. Kukci su razdvojenog spola. Kutikula štiti tijelo. Razvojni stadiji kod potpune preobrazbe su: jaje. uzgoj stanica i tkiva izvan organizma na posebnim hranjivim podlogama u strerilnim uvjetima. Dobro su razvijena osjetila za opip. Na njega se nastavlja ljestvičava živčana vrpca trbušnom stranom tijela. složenih šećera građenih od dvije molekule jednostavnih šećera. Razmnožavaju se jajima. ravnotežu. v. ličinka. Sistematski se kukci dijele na bezkrilce i krilaše. krtice i rovke. KULTURA TKIVA. Krvni optok je otvoren i jednostavan. Neki uzrokuju štete u poljoprivredi i šumarstvu. bezkrilci. svojta. Imaju slab vid. Na glavi imaju 1 par ticala i 1 par složenih očiju. sisanje (leptir). kukuljica i odrasli kukac.

LAP. rak bijelih krvnih stanica. Prostor između rožnice i leće . Cvjetovi su dvospolni. francuski zoolog tvorac prve potpune teorije evolucije nazvane lamarkizam. (1744. austrijski istraživač koji je 1900. a unutarnji dio siva tvar (u obliku leptira). sastavni dio središnjeg živčanog sustava svih kralje-žnjaka. smrtnost. bob i leća. Iza leće je stražnja očna komora ispunjena staklovinom. su segmentirani granulociti. Plod je mahuna. grah. LEPIRNJAČE. konstruiravši mikroskop s jed- nom lećom. LEPRA (guba).ispunjen je očnom vodicom. Vjenčić ima leptirast oblik (ime!) i sastoji se od pet latica. su monociti i limfociti. Mnoge se vrste uzgajaju za ishranu domaćih životinja. pa se zovu i mahunarke. LENTICELE. prvi ugledao živi jednostanični organizam. Karakterizira je smanjena otpornost na infekcije. LEUKEMIJA. Van LEEUWENHOEK A. koji su dobili imena prema afinitetu na kisele i lužnate boje. K. nizozemski prirodoslovac koji je 1674. J.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ LAMARCK. otkrio prve antigene. bočni meristemi LATIMERIJA. U čovjeka je smještena u gornje dvije trećine kralježničnog kanala. resoperke. LETALNE ILI SMRTONOSNE MUTACIJE. LEĆA (lens). (1868. (kralježnična moždina. LATERALNI MERISTEMI. – 1829. a 1940. LETALITET.). agranulociti. – 1943. npr. Kao i mozak građena je od sive tvari koju čine tijela živčanih stanica i bijele tvari koju čine živčana vlakna. Lepirnjačama pripada naše poznato povrće. v. nitrogene bakterije. LANDSTEINER. v. Pričvršćena je naokolo tankim nitima cilijarnog tijela koje mijenja sferni oblik leće i tako je prilagođava (akomodira) za gledanje blizu odnosno daleko. Kroz sredinu sive tvari prolazi središnji kanal ispunjen moždano – kralježničkom tekućinom (cerebrospinalni likvor) koji povezuje leđnu moždinu sve do šupljih komora unutar velikog mozga ispunjenih tekućinom (likvorom). čirevi u ustima. bazofilni i neutrofilni leukociti. v. Nesegmentirani leukociti. teška i dugotrajna. djetelina i lucerna.). Karakterizira je nenormalan rast i razvoj limfocita (limfatična leukemija) ili neutrofilnih leukocita (mijeloična leukemija). LEĐNA MOŽDINA. nalazi se odmah iza šarenice i zjenice. povećanost limfnih čvorova i slezene i opća slabost. – 1723. LEUCIN.). god. Listovi su im perasto sastavljeni. medulla spinalis). kemijski spoj iz skupine aminokiselina. pore na oplutjelim tkivima čiji se otvor ne može regulirati..prednja očna komorica .. Lepirnjače su važne i zbog simbioze s bakterijama. god. pore na kori bazge.. v. grašak. To su osjetilna i motorička vlakna refleksnih lukova. 78 . bakterijama uzrokovana bolest. LEUKOCITI (bijele krvne stanice) se dijele po obliku jezgre na segmentirane i nesegmentirane te da li imaju zrnca (granule) u citoplazmi nekih stanica (granulociti) ili ne (agranulociti). U leđnu moždinu ulaze i izlaze živčana vlakna na prednjim i stražnjim rogovima. zajedno s Winerom otkrio Rhesus faktor. cvijet. skupina pretežno zeljastih biljaka dvosupnica. mutacije koje obično dovode do smrti organizma. Eozinofilni.. Vanjski dio čini bijela. god. npr. (1632.

bjelančevina nazvanih imunoglobulini (Ig). leukemija. stanični organeli. a glavna joj je uloga donošenje suvišne tkivne tekućine u krv. stanje povećanog broja leukocita u krvi. LIMFA. stanične imunosti organizma jer je posredovana stanicama (limfocitima). LIMBIČNI SUSTAV. specifične imunosti. stanica nositelja tzv. LIMFATIČNA LEUKEMIJA. potporno staničje. LEUKOPENIJA. LIMFOCITI T. vrsta leukocita. Mnogo ih je na mjestima gdje je moguć prodor zaraznih klica (u plućima. LEYDIGOVE STANICE. Neutrofili imaju sposobnost fagocitoze (isp. LIKOVNICE. LIMFOCITI B. tjelesna tekućina koja teče limfnim žilama. humoralne imunosti. v.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Neutrofili i limfociti igraju važnu ulogu u zaštiti tijela. gomolji. LIMFOCITI 0. npr. Isp. U muškaraca je hormon LH nazvan hormon za stimulaciju intersticijskih stanica (ICSH). LIMFNI ČVOROVI. crijevu te ispod površine kože). dio velikog mozga u kojem se procjenjuju doživljaji i osloba- đaju emocionalne reakcije. stanje smanjenog broja leukocita u krvi. LIMFATIČNE STANICE. LEUKOCITURIJA. lijekovima i dr. ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi (isp. od tkiva prema srcu. Leukoplaste u kojima se šećer pretvara u škrob u obliku velikih škrobnih zrnaca nazivamo amiloplasti. vrsta leukocita. Ligamenti omogućuju pokretljivost zglobova upravljanu kontrakcijom mišića. Njihov broj je kod pojedinih ljudi različit (na crijevu čovjeka ih ima oko 30 000). jedan od tri gonadotropna hormona kojega izlučuje prednji režanj hipofize (adenohipofiza). krvna tjelešca. a pretežito se nalaze u spremišnim tkivima i organima (sjemenke. mikrobom) sazrijevaju u plazma . "stanice ubojice" (limfociti K i NK). LIGAMENTI (sveze). LH (luteinizirajući hormon). jer nakon što su bili u kontaktu s nekim antigenom (npr. nakupine limfnoga tkiva u vezivnoj čahuri razmještene po čitavom tijelu. sudjeluju u specifičnoj i nespecifičnoj staničnoj imunosti. nositelji tzv. LEUKOPLASTI. limfociti T i limfociti 0. a limfociti protutijelima štite tijela od zaraze. bijes i veselje. Ne sadrže biljna bojila. Raz- 79 . To su limfociti B. Dolaze u svim biljnim dijelovima (bezbojna primarna kožna tkiva listova i stabljika). v. Građeni su od čvrstog vezivnog tkiva u kojem ima elastičnih niti. crijeva i žučne vrećice. LEUKOCITOZA. vrsta leukocita. Može biti uzrokovana zračenjem. najmekši dio kostura. intersticijske stanice. Teče u jednom smjeru.stanice koje proizvode različite vrste specifičnih protutijela (antitijela).). srca. pojava leukocita u mokraći kod nekih bubrežnih bolesti.). korijen) biljaka. a impulsi utječu i na rad npr. različitim otrovima. v. Limbični sustav ulazi u sastav moždanog debla. stanice u koje su uključeni svi razvojni oblici limfocita. Sudjeluje i u prijenosu probavljenih masti iz crijevnih resica u krvotok. isp. a u čvoru je više limfatičnih čvorića (folikula) u čijim središtima se nalaze matične stanice za stvaranje limfocita. Pojedini limfni čvor sastoji se od kore i srži. Uzrok može biti u infekciji odnosno u povećanoj obrambenoj aktivnosti zaraženog tijela. a po sastavu se razlikuje od krvi jer ne sadrži eritrocite. nositelji tzv.

krvotvorni organi. zeleni organ u kojem se odvija fotosinteza. Drugo linjanje je u proljeće. LINIJA. 80 . LITORAL.-1778. Alge su zadržale sposobnost samostalnog života. vodu i minerale. Tri su glavna dijela lista: plojka. vodik i kisik. Životinje koje žive npr.). Alge pribavljaju organsku hranu za oboje. obalni pojas razine vode za vrijeme plime i oseke. geni su u kromosomima pravilno poredani u nizu. C. a gljive pružaju algama zaštitu. LIŠAJEVI (Lichenes).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ likujemo regulacijske (pomagačke i supresijske) i izvršne (efektorske) limfocite. v. vitice. linearno.Neki lišajevi imaju plodišta poput trubica u kojima je himenij s askusima. stanje porasta broja limfocita u krvi. vitamin D. LINJANJE. LIPOPROTEIN VRLO MALE GUSTOĆE (HLDL). čestice različitih masti i bjelančevina. enzimi iz skupine hidrolitičkih enzima koji sudjeluju u razgradnji lipida na njihove sastavne dijelove. prenosi kolesterol iz jetre u ostale dijelove tijela. Udružuju se u spužvasto tijelo koje također zovemo micelij. LIMFOCITOZA. to su supke ili kotiledoni (dijelovi embrija ili klica). kolesterol itd. u hladnim područjima imaju debelo krzno i linjaju se dva put godišnje. Listovi se mogu preobraziti u trnove. v. Dio prenesenog kolesterola taloži se u stijenkama krvnih žila i pridonosi nastanku ateroskleroze. životni oblici. U lipide ubrajamo i fosfolipide koji izgrađuju stanične membrane te steroide u koje ubrajamo spolne hormone. leukociti. kada nestaje debele dlake. prebacujući ga u mišiće i jetru. LIPOPROTEIN MALE GUSTOĆE (LDL). zaštitne i pricvjetne listove te cvijetne dijelove. LIPAZE. netopljivi su vodi. lisnate i grmaste lišajeve.. svojta. hormone kore nadbubrežne žlijezde. ali su topljivi u organskim otapalima. uklanja kolesterol iz krvi. švedski prirodoslovac. Najčešće se razmnožavaju soredijima. LINEARNI POREDAK GENA. U lipide ubrajamo i masti koje su po svom kemijskom sastavu esteri trovalentnog alkohola glicerola i viših masnih kiselina. osnivač taksonomije ili sistematike. LIMFOPOEZA. Dijele se prema obliku na koraste. U jesen postupno gube tanku ljetnu dlaku i raste im debela sa zimskom poddlakom. što je dokazao Morgan na temelju krosingovera (isp. Pioniri su vegetacije na Zemlji. LIMFOCITI. Gljive su mješinarke ili stapčarke. primjer simbioze dvaju različitih organizama gljive i alge. LIPIDI. a alge su jednostanične zelene ili modrozelene. LIPOPROTEIN VELIKE GUSTOĆE (HDL) uklanja kolesterol iz krvi. LINNE. stanje smanjenog broja limfocita u krvi. (1707. Prvi se listovi razlikuju od pravih. čvrsti dio Zemlje. Nalaze se na stabljici. Mogu biti vrlo različitih oblika. organski spojevi koji sadrže ugljik. peteljka i podina ili lisna baza. LIMFOPENIJA. mijenjanje dlake kod sisavaca. Zaslužan za uvođenje binarne nomenklature.). najčešće kao prilagodba na promjene temperature u okolišu. prebacujući ga u mišiće i jetru. Ima sisavaca koji mijenjaju dlaku postupno čitave godine bez obzira na godišnja doba. v. LITOSFERA. LIST.

šikara. makaki. čimpanza. orangutan. prava stabljika ili pravi listići.33 %). sporangij mejoza sporogon spore zigota klijanje spore oplodnja arhegonij (jaje) prokličnica odrasla mahovina anteridij (muška gameta) sporofit (2n) gametofit (n) MAJMUNI. Žive u toplim dijelovima Azije. gonadotropni hormoni. v. četkasti kromosomi. afrički mandril) i čovjekolike majmune (npr. Danas sudjeluju u stvaranju sedrenih barijera u vodotocima. voće i dr.66 %) i joda (0. kapucini). Razvili su se vjerojatno od primitivnih kukcojeda. To nisu pravi korijen. kemijski spoj iz skupine aminokiselina. LUTEOTROPNI HORMON. sifilis. skupina sisavaca s najrazvijenijim mozgom. LIZOSOMI. Služi za dokazivanje škroba s kojim daje ljubičastomodru boju. stabalce i listiće. pokretljivim prstima na dugačkim rukama i nogama te plosnatim noktima. Majmuni jedu gotovo sve. v. v. Ošteti li se njihova membrana počinju razgrađivati vlastitu stanicu. kalijevog jodida (0. kukce. LUBANJCI. Najrasprostranjenija je skupina lemura. Pravi majmuni se dijele na širokonosce (na pr. MAKIJA. v. ptice. gonadotropni hormoni. v. U određenom dobu godine na vrhu stabalca mahovine (nakon oplodnje) razvije se sporofit (sporogon) koji se sastoji od drška i tobolca za spore. Pioniri su vegetacije. stanični organeli obavijeni jednostrukom membranom.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE LIZIN. LTH (luteotropni hormon). plodove biljaka. MAKROELEMENTI. kopnene biljke kojima se gametofit (steljka ili talus) prilagodio životu na kopnu. očima usmjerenim prema naprijed. Od njih je nastao tresetni ugljen u prošlosti. sastoji se od. uskonosce (npr. Na gametofitu razaznajemo korjenčiće ili rizoide. Pomoću enzima razgrađuju složene organske spojeve i zbog toga imaju funkciju staničnog probavila. LUGOLOVA OTOPINA. To su mjehurići koji se odvajaju od Golgijeva tijela. LUES. elementarni sastav. Većinom se zadržavaju na drveću. a sadrže hidrolitičke enzime. v. Palac mogu primicati svim ostalim prstima i tako dobro obuhvaćati grane. LUMP BRUSH KROMOSOMI. Afrike i Amerike. Polumajmuni su primitivniji i žive na drveću. LUTEINIZIRAJUĆI HORMON. Dijele se na polumajmune i prave majmune. gorila).v. u vodi otopljenih. LH. gusta teško prohodna šuma karakteristična za Sredozemlje. 81 .svitkovci. M MAHOVINE.

Preci su im davni kolutićavci koji su prešli na sjedilački ili polusjedilački način života. te opisao živce. Tu će se hemoglobin iz krvi osloboditi viška ugljikovog dioksida i obogatiti kisikom (oksigenirati). Kontrolira mišićni tonus. Iz pluća se oksigenirana (arterijska) krv vraća u lijevu pretklijetku kroz dvije plućne vene. koljena). MALI (plućni) OPTOK KRVI. v. MAKROMOLEKULE. ježinac. žiroglavci. Ima dvije hemisfere. životinje iz skupine kolutićavaca.) i bradnjaci su bilateralno simetrične pokretne životinje koje ruju po morskom dnu. Klitelum služi pri razmnožavanju i stvara ovojnicu (kokon) oko oplođenih jaja koja ostavlja u zemlji. Postepeno se smanjio broj kolutića. a bjelančevine veći broj aminokiselina. MALPIGHIJEVE CJEVČICE.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MAKROEVOLUCIJA (adaptivna radijacija). MAKROSPOROGENEZA. Tijekom sistole lijeve pretklijetke krv se potiskuje u lijevu klijetku. sjemeni zametak. ticala ni oči. koja živi u tlu. Temeljna reakcija je: 82 . proces kojim se matična stanica embrijske vrećice u biljaka dijeli mejozom dajući četiri haploidne stanice od kojih tri propadaju. redova. MALPIGHI. Time je ona jedina preživjela makrospora iz koje će se razviti ženski gametofit (haploidna generacija). mikroskopom proučavao građu životnja i prvi vidio kapilare. MAKROSPORANGIJ.). MALOKOLUTIĆAVCI (Oligomeria). isp. plazmodij. a odatle snažnom kontrakcijom u aortu tj. deoksigenirana (venska) krv se iz srca sistolom (kontrakcijom) desne klijetke izbacuje u plućnu arteriju odnosno u pluća. MALI MOZAK (cerebellum). evolucijski procesi iznad razine vrste koji vode nastajanju viših sistemskih grupa odnosno velikih skupina (rodova. v. bradnjaci i streličari. Žive na kopnu i u slatkim vodama. organi za izlučivanje i osmoregulaciju tjelesnih tekućina kod većine člankonožaca: klještara i uzdušnjaka. MAKROSPORA. v. Po njemu je nazvano Malpighijevo tjelešce u nefronu bubrega i Malpighijev sloj kože. osigurava ravnotežu.pas ili klitelum. Nemaju parapodije.. ispod velikog mozga. MASLAČNO VRENJE. Građen je od vanjske sive i unutarnje bijele tvari. zvjezdača i zmijača). MALARIJA. M. ali i fermentacije različitih sireva (rupice!). To su cjevasta izbočenja crijeva u tjelesnu šupljinu. Najvažnije makromolekule živih organizama su nukleinske kiseline i bjelančevine. stoji u temelju kvarenja maslaca. Produkti izmjene tvari filtriraju se u cjevčice i pražnjenjem crijeva izlaze van. (1628. kožu i bubreg. bodljikaši (trp. Duž tijela su poredane četine. razreda. koordinira mišićne kretnje.-1694. mutacije u genu koji kontrolira bitne metaboličke procese u organizmu. Nukleinske kiseline izgrađuje veći broj nukleotida. Najpoznatija vrsta je gujavica. porodica. Na pojedinim su susjednim kolutićima jako razvijene žljezdane stanice koje luče sluz i stvaraju zadebljanje . MALOČETINAŠI. velike molekule građene od većeg broja manjih podjedinica. životinje iz skupine bezkralježnjaka. sjemeni zametak. Najpoznatiji su lovkaši. a jedna se razvija u embrijsku vrećicu. a simetrija tijela je kod nekih oblika prešla iz dvobočne u zrakastu simetriju. Žiroglavci (isp. talijanski biolog. leži u stražnjem dijelu lubanje. MAKROMUTACIJE. u veliki optok krvi.

MEGAEVOLUCIJA (aromorfoza). benzenu. MEHANIZAM POVRATNE SPREGE (mehanizam povratne veze). v. mehanizam povratne sprege. evolucija osnovnih i najviših sistematskih skupina živoga svijeta prilikom prijelaza živog svijeta iz jednog medija u drugi primjerice iz vode na kopno. Kod žena je to kruškoliki. krosingover). dioba kojom počinje nastanak spolnih stanica. MEJOZA (zoridbena dioba. Pretpostavlja da je uzročnik te bolesti sitna bakterija. ali se dobro otapaju u eteru. govorimo o oogenezi. mišićni organ smješten u donjem trbuhu. princip na kojem se temelji rad svih žlijezda s unutarnjim izlučivanjem. v. MEDUZA. MEGAKARIOCITI. složeni organski spojevi sastavljeni od trovalentnog alkohola glicerola i masnih kiselina. v. MASTI. metafaza I. a nastaju li muške gamete.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE C6H12O6 → 2CO2 + 2H2 + energija + + 2CH3CH2CH2COOH maslačna kiselina MASNE NASLAGE (aterom). Osnovna značajka mejoze je da u njoj dolazi do redukcije broja kromosoma. Izgledom je slična zvonu ili klobuku. Unutarnja je stijenka maternice obložena sluznicom (endometrijom) koja se u vrijeme menstruacije oljušti. a druga je slična mitozi. tijela i vrata (cervix) maternice. redukcijska dioba). Najvažnija zbivanja u mejozi I su redukcija broja kromosoma te rekombinacija homolognih kromosoma (isp. Stanice (gamete) koje nastaju mejozom su genetički različite zbog pojave crossing overa. Vrat maternice vodi u rodnicu. smanjena količina muškog spolnog hormona testosterona u krvi potaknut će izlučivanje faktora oslobađanja gonadotropnih hormona iz hipotalamusa. tada govorimo o spermatogenezi. spermiji. Kroz taj kanal izlazi menstruacijska krv. a u maternicu ulaze spermiji. a lovke su na rubu zvona. Time će se ponovno uspostaviti potrebna koncentracija testosterona u krvi. Usna (oralna) strana je u unutarnjosti. U sastavu masnih kiselina dominiraju zasićene masne kiseline. MEHANIZAM POVRATNE VEZE. MEJOZA I (prva mejotička dioba). krvotvorni organi i koštana moždina. 83 . Proces nastajanja gameta mejozom naziva se gametogeneza. organ u kojem se razvija plod (kod većine sisavaca). stanična dioba kojom nastaju spolne stanice. Na primjer. MEDICINSKA MIKROBIOLOGIJA. Sastoji se od dna. ateroskleroza. njemački znanstvenik koji je istraživao mozaičnu bolest duhana. a u trudnoći stvara posteljicu. Prema tom principu svaka promjena koncentracije nekog hormona u krvi utječe na rad hipotalamusa i hipofize koji će normalizirati koncentraciju tog hormona. Mejoza se sastoji od dvije uzastopne diobe od kojih je prva redukcijska (mejoza I). Tako iz jedne stanice s diploidnim brojem kromosoma (2n) nastaju 4 stanice s haploidnim brojem kromosoma (n). v. Ne otapaju se u vodi. Ti faktori potaknut će izlučivanje gonadotropnih hormona iz adenohipofize koji će zatim povećati izlučivanje testosterona iz testisa. U stanici služe kao pričuva energije.. Ako nastaju ženske gamete. mikrobiologija. anafaza I i telofaza I. Sastoji se od 4 uzastopne faze: profaza I. A. MATERNICA (uterus). MAYER. jajne stanice. jedan od morfoloških oblika kod žarnjaka. gamete. Meduza je slobodno plivajući oblik. kloroformu i sl.

Proizvodnja pigmenta u koži pod kontrolom je hormona . Pretjerano izlaganje kože ultraljubičastim zrakama može dovesti do pojave tumora –melanoma. stanice koje se nalaze između bazalnih stanica epiderme kože. Mekušci su razdvojena spola. kopnenim vodama i na kopnu. Oplodnja je vanjska ili unutarnja. v. v. melanociti. Mekušci su većinom bilateralno simetrični. proteini koji dolaze u sastavu stanične membrane.smeđi ili žuti) koji koži daju boju.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MEJOZA II (druga mejotička dioba). beskralježnjaci. ticala i osfradiji. Pigment se u melanocitu nalazi u melanosomima koji štite kožu od štetnog djelovanja ultraljubičastih zraka. G. MELANOM. MEKUŠCI (Mollusca). školjkaši i glavonošci. Ličinački stadiji su trohofora i velinger-ličinka. Živčani sustav se sastoji od više parnih ganglija međusobno povezanih živčanim vrpcama.j. MELANOCITI. Srce je građeno od klijetke i jedne ili više pretklijetki.). Sastoji se od 4 uzastopne faze: profaza II. Zbivanja tijekom mejoze II slična su zbivanjima tijekom mitoze (isp. metafaza II. Neki su proteini samo djelomično uronjeni u dvosloj fosfolipida dok se drugi protežu kroz čitavu debljinu lipidnog dvosloja tvoreći proteinske “kanaliće”. MENDELOVI ZAKONI. luči ga srednji režanj hipofize. najrazvijenija i vrstama najbogatija skupina beskolutićavaca. dijelova mora i reguliranje tekućih voda u svrhu dobivanja plodnog i obradivog tla. melanociti. MENARHA. mišićavo stopalo i utrobna vreća s unutarnjim organima. a rjeđe u mrežnici oka. Optjecajni sustav je otvoren t. češki znanstvenik koji je godine 1865. maligni tumor koji se najčešće javlja u koži.). statocisti. Organi za disanje su škrge (ktenidije) ili "pluća" t. Tumorske stanice sadrže različite količine melanina. Najrasprostranjeniji mekušci su: puževi. dio plašta kod kopnenih puževa.oksidaze i drugih sintetizira pigment melanin (crni) i feomelanin (crveno . Osjetni organi su oči. Tijelo je mekano i obavijeno plaštem. Probavilo je prohodno. U ustima je trenica ili radula. melanociti. Žive u moru. melas = crn).j. Poznato je više od 100 000 vrsta. dioba kojom završava nastanak spolnih stanica. pigment crne boje koji se stvara u koži kao zaštita od štetnog djelovanja UV zraka.MSH (melanocit stimulacijski hormon) iz srednjeg režnja hipofize. opsežni zahvati isušivanja močvarnih terena. Za izlučivanje imaju metanefridije. (1822. Krvni ili dišni pigment se naziva hemocijanin. MELANOCIT STIMULACIJSKI HORON (MSH). ali ima i dvospolaca. U njima se iz aminokiseline tirozina uz pomoć enzima fenol . MELANIN (grč. Mekušci su bogati bjelančevinama i vitaminima pa se rabe za hranu. prvo menstrualno krvarenje iz spolovila u djevojčica u pubertetu. Plašt izlučuje vapnenu ljušturu: kod puževa jednodjelnu (kućicu) a kod školjkaša dvodjelnu (školjku). zakoni nasljeđivanja koje je postavio Mendel radeći 84 . Neki od njih su i enzimski aktivni. Probava je izvanstanična (u želucu) i unutarstanična (u probavnoj žlijezdi). anafaza II i telofaza II. a služi za raspodjelu kožnog pigmenta melanina. MENDEL. MELIORACIJE. Na tijelu se mogu razlikovati: glava. krv istječe iz krvnih žila i oplakuje tkiva i organe. – 1884. MEMBRANSKI PROTEINI. v. Poznati su Mendelovi zakoni u kojima je iznio osnovne zakonitosti nasljeđivanja. objasnio mehanizme prenošenja nasljeđa s roditelja na potomstvo.

faza s povećanom sek- 85 . MENSTRUALNI CIKLUS (menstruacijski ciklus). 2. Zakon jednoličnosti (uniformnosti) F1 generacije: križaju li se homozigotni roditelji. v. benignim tumorm maternice. Zakon nezavisnosti nasljednih faktora: kada se križaju jedinke s više svojstava pojedina se svojstva nasljeđuju nezavisno. kao npr. uz izbacivanje većih ugrušaka krvi. tj.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE pokuse s biljkama. u kojoj jajna stanica konačno dozre. obilne menstruacije koje traju dulje od sedam dana. obično svakih 28 dana. maternica se priprema za prihvat zametka ako dođe do oplodnje. Zakon cijepanja (segregacije) svojstava u F2 generaciji po stalnim brojčanim odnosima: međusobnim križanjem jedinki F1 generacije nastaju potomci s različitim svojstvima i to: a) kod monohibridnog križanja s dominacijom u omjeru 3:1 u korist dominantnog oblika. tj. svi potomci F1 generacije su međusobno jednaki. D .bazalne temperature. Treća je sekrecijska faza. B – količine estrogena i progesterona. što znači da se aleli u zigoti ne spajaju nego samo mozaično kombiniraju. mjesečnica. b) kod monohibridnog intermedijarnog križanja u omjeru 1:2:1.plodnih i neplodnih dana. ženski spolni ciklus karakteriziran periodičkim promjenama koje se odvijaju u jajnicima i maternici. a završava se ovulacijom i traje 2 do 3 dana. menstruacijskim krvarenjem (3 do 5 dana). Postoje tri Mendelova zakona: 1. MENINGITIS. Mogu biti uzrokovane hormonalnim poremećajem ili različitim patološkim razlozima. miomom.količine gonadotropnih hormona. Tada iz spolnih centara u mozgu dolaze impulsi do hipofize u kojoj se počinju izlučivati gonadotropni hormoni koji pak u jajnicima potiču sazrijevanje jajnih stanica i izlučivanje žen- skih spolnih hormona. MENORAGIJE. Istovremeno. U slučaju da jajašce nije oplođeno sluznica maternice se ljušti i ta se pojava naziva menstruacija ili mjesečnica koja se ponavlja u pravilnim razmacima. upala mozgovnih ovojnica i leđne moždine mikroorganizmima iz krvotoka ili onima koji su dospjeli u tijelo ozljedom glave. Prva je folikularna faza koja počinje mjesečnicom. 3. Zakoni vrijede kod biljaka. Druga faza je ovulacijska faza. životinja i čovjeka. Menstrualni ciklus se dijeli u tri uzastopne faze. U toj fazi u jednom mjehuriću započinje sazrijevanje jajne stanice (traje oko 12 dana). MENSTRUACIJA. a započinju u pubertetu. C . Prikaz promjena tijekom menstrualnog ciklusa: A .

METABOLIZAM MASTI. METIONIN. beskolutićave životinje koje pripadaju koljenu plošnjaka. To su otvorene cjevčice koje na vrhu imaju trepetljikavi lijevak koji skuplja izlučevine iz tjelesne šupljine. zoofagi. kemijski spoj iz skupine aminokiselina. karnivorne biljke. plazmodij. ovčji metilj. jedna od etapa stanične diobe . 86 . organi za izlučivanje kod mekušaca i kolutićavaca. skup svih biokemijskih reakcija u organizmu kojima se iz proteina dobiva energija. v. METAFAZA. v. METAFAZA I. METAFAZA PRVE MEJOTIČKE DIOBE. MESOJEDI. METABOLIZAM UGLJIKOHIDRATA. (metafaza druge mejotičke diobe). v. v. a najčešće je to puž. karnivori. (metafaza prve mejotičke diobe). METAFAZA II. v. METAZOA. isp. mnogostanične životinje. METAFAZA DRUGE MEJOTIČKE DIOBE. jedna od etapa redukcijske diobe mejoze I u kojoj su konjugirani kromosomi (spareni homologni kromosomi) smješteni u središnjoj ili ekvatorijalnoj ravnini. preobrazba. kromosom koji ima svoju pričvrsnicu u sredini. METABOLIZAM PROTEINA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ recijom hormona progesterona i estrogena. Anaerobni su organizmi kao i drugi crijevni nametnici. Dvospolci su i za razvitak im je potreban barem jedan međudomadar. Metabolizmom proteina upravljaju hormoni iz kore nadbubrežne žlijezde. METACENTRIČAN KROMOSOM. METANEFRIDIJI. v. Nakon oplodnje razvija se trepetljikava ličinka planula koja se pričvrsti za dno i razvije u polip. v. v. isp. MERISTEM. METILJI. Tijelo im je prekriveno kutikulom i imaju prianjalke na prednjem dijelu tijela. Polipi mnogih obrubnjaka i režnjaka pupanjem stvaraju meduze koje se otkidaju i kada postanu spolno zrele proizvode jaja i spermije. METAMORFOZA. Traje 13 do 14 dana. U metafazi II broj kromosoma u svakoj stanici je polovičan (haploidan) s obzirom na broj kromosoma na početku mejoze I. skup svih biokemijskih reakcija u organizmu kojima se iz masti dobiva energija. U cjevčicama se stvara mokraća i izbacuje kroz otvore metanefridija van. metafaza II. METABOLIČNA VODA je voda koja nastaje tijekom metabolične razgradnje ugljikohidrata. skup svih biokemijskih reakcija u organizmu kojima se iz ugljikohidrata dobiva energija. METILJAVOST. masti i bjelančevina iz hrane. METANEFROS. tvorno staničje. MESOJEDNE BILJKE. jedna od etapa mejoze II u kojoj su jednostruki kromosomi smje-šteni u središnjoj ili ekvatorijalnoj ravnini. MEROZOITI. S padom koncentracije estrogena i progesterona nastupa opet mjesečnica. treći bubreg.mitoze u kojoj su kromosomi pravilno smješteni u sredini stanice u središnjoj ili ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena. isp. v. Najprepoznatljivija vrsta je ovčji metilj. METAGENEZA. v. metafaza I. Opisano je oko 11000 vrsta metilja koji su nametnici u probavilu sisavaca. izmjena nespolne generacije sjedilačkih polipa i spolne generacije meduza u životnom ciklusu žarnjaka.

najmanji (0. fyllon = list). a za uzvrat biljke gljive opskrbljuju organskom hranom. npr. v. srce i krvne žile. veliki i mali vijak. tkivo lista koje se nalazi između gornje i donje epiderme. instrument pomoću kojeg se mogu promatrati predmeti nevidljivi ljudskom oku.1 – 0. ježinaca) i svih kralježnjaka. U kralježnjaka. MICELIJ. Optički 87 . specijalizirano za obavljanje procesa fotosinteze. Mehanički dijelovi su podnožje. hrskavica. limfatički organi itd. otvor na sjemenom zametku. Tu pripada većina našeg listopadnog drveća i kulturnih biljaka. MIKROSFERE. bakterije. gastrulacija. Mikrosfere je u svojim pokusima dobio američki biokemičar Fox. srednji zametni listić koji se formira tijekom druge etape embrionalnog razvoja. mesos = srednji. gastrulacije u nekih bezkralježnjaka (npr. MIKORIZA. MIJELOM. stalak. MIKROEVOLUCIJA. MIKOPAZMODIJI. tučak. Njegovi pokusi pridonijeli su razumijevanju razvoja živog svijeta na Zemlji. Također i spužvasto tijelo lišajeva (isp. spolne žlijezde. elementarni sastav. biocenoza mikroorganizama. MEZOFIL (grč. združivanje gljiva i viših biljaka pri čemu hife gljiva obavijaju korjenje biljaka preuzimajući ulogu korijenovih dlačica od kojih su djelotvornije. MIKOPLAZME (mikopazmodiji). MEZOFILNE ŽIVOTINJE (grč. Svjetlosni mikroskop građen je od mehaničkih i optičkih dijelova. v. industrijska mikrobiologija itd. prehrambena mikrobiologija. stolić. kosti. MIKROSKOP. v. MIKROELEMENTI. ali za razliku od većine osta- lih prokariota ne sadrže staničnu stijenku. MIKROBIOCENOZA. Njihove stanice sadrže i DNA i RNA. fyton = biljka). a obavijene su plazmatskom membranom. životinja i biljaka. znanost koja se bavi proučavanjem mikroskopski sitnih organizama. v. tubus. leukemija. mesos = srednji. biljke prilagođene životu na umjereno vlažnim staništima. selidbe riba.). medicinska mikrobiologija. mutacije gdje se teško uspostavi međuodnos između promjene genotipa i neke fenotipske karakteristike. MEZONEFROS. iz mezoderma se razvijaju: mišići. vegetativno tijelo gljiva izgrađeno od nitastih tvorevina zvanih hife. mesos = srednji. Neke mikoplazme uzrokuju bolesti čovjeka. MIGRACIJA RIBA. MIKROMUTACIJE. MIKROPILA. MEZOFITI (grč. MEZOSOMI. Zbog velikog područja istraživanja i široke primjene mikrobiologija se dijeli na mnogo grana. Isp.3 μm) i najjednostavniji prokarioti (isp. Tu pripada većina kopnenih organizama. odnosno populacije. v. procesi evolucije u kraćim razdobljima koji se zbivaju na razini postanka vrste. filos = prijatelj).). MIKROBIOLOGIJA. v. okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama.stanica u koštanoj moždini.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE MEZODERM. v. mikoplazme. bolest prekomjernog umnožavanja plazma . Nastaje iz dijela endoderma koji se useljava u prostor blastocela. životinje prilagođene životu na umjereno vlažnim staništima. drugi bubreg. MIJELOIČNA LEUKEMIJA.

američki znanstvenik koji je. Jednak je umnošku dišnog volumena i frekvencije disanja.). npr. proces kojim nastaju peludna zrnca (mikrospore). Umnožak je broja otkucaja srca u minuti i udarnog volumena srca (npr. bakar (Cu). 70 x 70 mL = 4900 mL/min). je ukupna količina novog zraka koji svake minute dospije u dišne putove. Elektronskim mikroskopom možemo vidjeti predmete promjera manjeg od 1 nm. a primjenom posebnih objektiva (imerzija) do 1000 puta.). S. u laboratorijskim uvjetima dobio aminokiseline i neke druge organske spojeve. MIKROSPORA. isp. v. prašnik. (rođ. Polarizacijskim mikroskopom vidljiva je fina građa i kristalna struktura preparata na osnovi pojave dvoloma svjetlosti pri prolazu kroz preparat. MINERALI. MIOFIBRILE. v. minutni volumen disanja iznosi oko 6000 ml ili 6 litara u minuti (u mirovanju). MIMIKRIJA (grč. okulari i kod nekih koji nemaju ugrađenu rasvjetu zrcalo. Faznim mikroskopom mogu se istraživati neobojene stanične strukture koje se razlikuju samo u indeksu loma svjetlosti. 88 . 1930. cink (Zn) itd. magnezij (Mg) je sastavni dio klorofila. Fe. Umjesto staklenih leća koje ima svjetlosni mikroskop elektronski mikroskop ima prstenaste elektromagnete (elektronske leće). poprečno-prugasti mišić. Školski mikroskopi povećavaju 400-600 puta. Normalni dišni volumen iznosi oko 500 ml. Fluorescencijski mikroskop omogućuje otkrivanje sitnih struktura preparata (stanične bjelančevine i dr. Miller. volumen krvi koje srce utisne u krvotok u minuti. Mg. v. srčani mišić. tanka proteinska vlakna koja izgrađuju mišićno tkivo. MINERALNE TVARI (minerali). Elektronski mikroskop umjesto vidljive svjetlosti koristi snop elektrona koji prolazi kroz tanki prerez mikroskopskog preparata čija slika postaje vidljiva na fluorescentnom zaslonu. obilježje nekih životinja da bojom i oblikom tijela oponašaju druge životinje ili predmete iz svojeg okoliša u svrhu zaštite od neprijatelja. za život važnih spojeva.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ dijelovi su kondenzor s iris-zaslonom. MIKROSPOROGENEZA. Različiti mikroskopi imaju različitu moć razlučivanja (isp. imitirajući uvjete koji su vladali u prvom razdoblju postanka Zem- lje. predatora. polarizacijski i fluorescencijski mikroskop. U biološkim istraživanjima koriste se i neki posebni tipovi mikroskopa: fazni mikroskop.. v. prašnik. mineralne tvari. molekule) na osnovi fluorescencije. kalcij (Ca) kostiju i zubi. mimeomai = oponašam). MIOZIN. prašnik. MINUTNI VOLUMEN DISANJA. Pojedini elementi koji izgrađuju minerale su sastavni dio mnogih. Mijenja se tijekom različitih aktivnosti tijela. MINUTNI VOLUMEN SRCA. MIKROSPORANGIJ. Prema tome. Na primjer. Mehanički dijelovi nose optičke dijelove i služe za njihovo pomicanje i namještanje predmeta promatranja. objektivi. poprečnoprugasti mišić. a normalna frekvencija disanja oko 12 puta u minuti. MILLER. jod (I) je potreban za stvaranje hormona štitnjače. tiroksina. v. a mnogi su sastavni dijelovi enzima. isp. MILLEROV POKUS. MIOKARD. željezo (Fe) hemoglobina. anorganski prirodni spojevi. Optički dijelovi omogućuju osvjetljavanje i povećavanje promatranog predmeta. bjelančevinasta molekula koja izgrađuje miofibrile.

npr. himeniju. dvostruki (2n) broj kromosoma kao i stanica od koje su nastale. većinom nakon sezone parenja. životinje iz skupine kolutićavaca. povećava se i ukupni broj miofibrila u vlaknu. MLIJEČNO-KISELO VRENJE. dojenju i klimakteriju. glatki mišići i srčani mišić koji se sastoji od poprečnoprugastih međusobno spojenih vlakana. Imaju sposobnost umnožavanja neovisno od diobe stanice. Promjeri pojedinih mišićnih vlakana postaju veći. U njima se nalaze dišni enzimi. v. dioba somatskih (tjelesnih) stanica. Budući da pero nije živa struktura. MJEŠČIĆNICE. mjesečno krvarenje kod žena koje se pojavljuje redovito. Lactobacillus bulgaricus i Streptococus lactis. Žive u moru kao pokret- 89 . laktoza. kržljanje mišića uslijed slabe mišićne aktivnosti ili prestanka upotrebe pojedine skupine mišića. v. omogućuju pokretanje tijela i njegovih pojedinih dijelova. anafaze i telofaze. a unutarnjost im je ispunjena žitkom masom koja se zove matriks (matrix). Postoje tri vrste mišića: poprečnoprugasti mišići. stanični organeli koji se nalaze u citoplazmi eukariotskih stanica. Mitarenje kontrolira štitna žlijezda. MIŠIĆNA HIPERTROFIJA. tartufi (gomoljače) itd. postupak kojim se dolazi do kislog mlijeka i kupusa. Ptice se mitare jedanput ili dva put godišnje. Menstruacijska krv je razgrađena sluznica maternice (endometrij) pomiješana sa krvi iz kapilarne mreže koja je hranila endometrij. RNA. mijenjanje perja kod ptica. zelene plijesni. a uzrokovano je anaerobnim bakterijama. MJEŠINARKE. MIŠIĆNA ATROFIJA. v. Temeljna značajka mitoze je da ovom diobom nastaju dvije stanice koje imaju isti. MIŠIĆI. Unutarnja membrana tvori mnogostruke nabore koji mogu biti u obliku grebena i pregrada (kriste) ili poput cjevčica. MITOZA. ovčji metilj. Prijenos podražaja sa živca na mišićno vlakno odvija se na živčano mišićnoj vezi. osim u trudnoći. U mitohondrijima se odvija proces staničnog disanja pri kojem se dobiva energija potrebana za stanične aktivnosti. Mješinice stručno zovemo askusima. MITARENJE. isp. kefira i sl.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE MIRACIDIJ. kopnene gljive s micelijem građenim od vrlo dugih hifa s poprečnim stijenkama. plaštenjaci. metafaze. jogurta. ono otpada. U osnovi je proces: C6H12O6 → 2CH3CHOHCOOH mliječna kiselina MNOGOČETINAŠI. Mišići energiju dobivaju razgradnjom glukoze (reakcija glikolize) i glikogena. menstrualni ciklus. MLIJEČNI ŠEĆER. Imaju izraženu izmjenu generacija gametangiogamijom i kariogamijom. isp.. a staro se perje zamjenjuje novim. smrčci. Sastoji se od četiri glavne faze: profaze. povećanje mišićne mase uzrokovano povećanom mišićnom aktivnošću. a spore askosporama. v. Povećava se kapilarna mreža i opskrba kisikom i hranidbenim tvarima. MJESEČNICA (menstruacija). U matriksu se nalazi DNA. ribosomi. Askusi se razvijaju na posebno građenom jednoslojnom plodištu. svakih 28 dana. poprečnoprugasti mišić. Spore im se razvijaju u mješinicama. Predstavnici mješinarki su kvaščeve gljivice. Obavijeni su dvostrukom membranom. Mišić postaje tanji i slabih kontraktilnih sposobnosti. MITOHONDRIJI. skraćivanjem (kontrakcijom) i opuštanjem (relaksacijom). Zbog toga se mitohondriji još nazivaju i “energetskim centralama” stanice. v.

L. spore. model membrane koji su zamislili S. završni dio mokraćnog sustava. a time i u razvoju života na Zemlji. ticala i pipala (palpi). nenasljedne promjene organizma nastale pod utjecajem okoliša.5 nm. Također provode fiksaciju dušika iz zraka. a u žena samo mokraće. MODEL TEKUĆEG MOZAIKA. Svi imaju celom ili sekundarnu tjelesnu šupljinu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ni ili sjedilački oblici. malokolutićavce i svitkovce. Na primjer. izlučevina bubrega kojom se iz organizma odstranjuju čovjeku suvišne i štetne tvari topljive u vodi. Prema tom modelu neke membranske bjelančevine su na površini (periferni proteini). Nicolson. Kao prvi pravi fotosintetski organizmi. također prokariotskim organizmima. a druge su djelomice ili potpuno uronjene (integralni proteini) u dvosloj lipida. Mnogi ruju po dnu praveći hodnike. Nikad nemaju bičeva. Unutarnji organi uglavnom prate vanjski kolutićavi raspored. Nemaju plastide. Cjevaši izlučuju oko tijela cijev od vapnenca. Svjetlosnim mikroskopom u najboljem slučaju mogu se razlučivati točke udaljene jedna od druge 0. MOKRAĆNA CIJEV (uretra). MOKRAĆNI MJEHUR. To su bubreg. MODIFIKACIJE (somatske varijacije). v. Kod člankonožaca kolutićavost nije jasno izražena. sposobnost mikroskopa da dvije bliske točke prikaže razdvojeno. a pri 25 °C bijelo.2-0. Tijelo im je bilateralno simetrično i podijeljeno na kolutiće. mnogostanične životinje. ali za razliku od bakterija koje sadrže bakterioklorofil. Kod čovjeka se sastoji od nekoliko organa koji su smješteni u trbušnoj šupljini iza potrbušnice. MOĆ RAZLUČIVANJA. najbrojnija skupina beskralješnjaka. MODROZELENE ALGE (cijanobakterije). neparni šuplji organ smješten u maloj zdjelici. Razlikujemo pet organizacijskih tipova: spužve. Na glavi su usta. U Jadranu su poznati: afroditin palolo i morska gusjenica. sustav organa koji mokraćom izlučuje štetne tvari iz organizma. mnogostaničari). oči. Njihova biomasa na kraju životnog ciklusa se i raspada uzrokujući onečišćenje. mnogokolutićavce. Negativni utjecaj ima njihovo naglo vegetativno razmnožavanje u moru poznato pod nazivom “cvjetanje mora”. MNOGOSTANIČARI. Mogu prijeći i u trajni oblik. se sastoje od velikog broja specijaliziranih stanica različitih oblika. Raspored bjelančevina u membrani nije stalan već se mijenja ovisno o stanju stanice. mokraćni mjehur i mokraćna cijev (uretra). Mogu se kromatski adaptirati.J. MNOGOKOLUTIĆAVCI (Polymeria). U osnovnoj građi su slične bakterijama.2-0. To su autotrofni fotosintetski organizmi. U muškaraca služi provođenju i mokraće i sperme. MNOGOSTANIČNE ŽIVOTINJE (metazoa. sobni jaglac pri temperaturi od 10 °C cvate crveno. MOKRAĆA (urin). pretpostavlja se da su odigrale odlučujuću ulogu u stvaranju atmosferskog kisika.4 μm. a služi za 90 . pripadaju im: kolutićavci i člankonošci. mokraćovod (ureter). mitohondrije ni golgijeva tjelešca.Singer i G. Po građi i funkciji različita je u muškaraca i žena. beskolutićavce. a elektronskim mikroskopom može se postići razlučivanje od 0. modrozelene alge sadrže klorofil. MOKRAĆNI (urinarni) SUSTAV. jednostanične biljke koje nemaju potpuno izgrađenu jezgru i zbog toga ih ubrajamo u prokariote. Najčešće se razmnožavaju vegetativno. Na svakom kolutiću imaju parapodije na kojima su četine (hete).

) MONOMERI. Aa. a2). Razlika postoji u označavanju alela jer su ovdje aleli podjednako vrijedni te ih sve označujemo malim slovima (a1. v. Njihovim križanjem dobit ćemo u F1 generaciji sve ružičaste jedinke (a1a2) jer nema dominantnog alela pa se pojavljuje srednji (intermedijarni) fenotip. F2. Na izlasku iz mjehura je prstenasti mišić (sfinkter) koji je pod nadzorom simpatikusa i parasimpatikusa. građevne podjedinice polimera. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. a recesivni malim. Posebice se bavi proučavanjem odnosa između makromolekula DNA. P generaciju predstavljaju: homozigotni visoki grašak (AA) i homozigotni niski grašak (aa). Visok rast je dominantno svojstvo te ga označujemo velikim slovom (A). U sljedećem primjeru križanja početnu roditeljsku P (parentalnu) generaciju čine homozigotna crvena zijevalica (a1a1) i homozigotna bijela zijevalica (a2a2). MONERE. npr. oštećene ili mrtve stanice i nepotrebne bjelančevine. Prosječno može u odrasle osobe primiti oko 500 mL mokraće. pokretni leukociti. MONOHIBRIDNO INTERMEDIJARNO KRIŽANJE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE skupljanje mokraće nastale u bubrezima. Mokraću iz mokraćnog mjehura odvodi izvan tijela neparna mokraćna cijev (uretra). aminokiseline su podjedinice proteina. Dodatak 1. ružičasti (genotip a1a2) i bijeli (genotip a2a2) u omjeru 1:2:1. F3 itd. koju dobijemo međusobnim križanjem jedinki F1 generacije. tanka cijev dužine oko 25 cm koja se obostrano iz bubrežne nakapnice spušta u mokraćni mjehur s njegove gornje strane. MONOSAHARIDI. v. znanost koja proučava životne procese u stanici na razini molekula. Sfinkter se otvara refleksno kada tlak mokraće podraži receptore u stijenci mokraćnog mjehura. v. MONONUKLEOTIDI. 91 . MOKRAĆOVOD (ureter). Sudjeluju u imunološkim reakcijama obradom antigena ili fagocitiraju raličite čestice. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slojevima. (V. shemu u Dodatku 1. jedan oblik križanja u kojem se prati nasljeđivanje jednog svojstva. I u ovom primjeru križanja kao i u primjerima križanja s dominacijom. a jednostavni šećeri polisaharida. a nizak rast je recesivno svojstvo te ga označujemo malim slovom (a).) MONOHIBRIDNO KRIŽANJE S DOMINACIJOM.makrofage. uključujući mikroorganizme. Downov sindrom MONOCITI. isto što i nukleotidi. MONGOLIZAM. (V. RNA i proteina. jedan tip križanja u kojem se prati nasljeđivanje jednog svojstva i u kojem nema dominantnog alela za takvo svojstvo. pojavljuju se tri fenotipa: crveni (genotip a1a1). a generacije potomaka (filijalne) prema redoslijedu s F1. Međusobnim križanjem jedinki F1 generacije dobiva se potomstvo F2 generacije u kojem je 75 % jedinki visokog rasta (AA. ugljikohidrati. nukleotidi nukleinskih kiselina. spadaju u velike fagocite . Ako se želi saznati da li je jedinka homozigotna (AA) za dominantno svojstvo ili heterozigotna (Aa) tada se provodi test križanje. aA). početna roditeljska generacija i generacije potomaka označuju se odgovarajućim slovima. a 25 % jedinki niskog rasta (aa) što znači da je omjer fenotipa 3:1. U F2 generaciji. MOLEKULARNA BIOLOGIJA. u ovom primjeru to je visina stabljike graška. prokarioti. Njihovim križanjem dobit će se svi visoki potomci (Aa) koji predstavljaju F1 generaciju.

5 pari slabinskih. Mjesto na kojem vidni živac izlazi iz mrežnice naziva se "slijepa pjega". pokretački živčani sustav. blastulu. kožna vrećica u kojoj se nalaze testisi. messenger RNA). vrat i unutarnje organe u prsnoj i trbušnoj šupljini. moždani živci. izlaze iz leđne moždine. npr. srednji mozak. U jednom organizmu za jedno fenotipsko svojstvo 92 . B i 0. MOŠNJA (scrotum). MOZGOVNI ŽIVCI. MREŽNICA (retina). v. MOŽDINSKI (kralježnički) ŽIVCI.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MORFOGENETSKA KRETANJA. v. te velike motoričke jezgre koje imaju važnu ulogu u mišićnim radnjama kao što su: stajanje. MORULA. informacijska RNK ili iRNK. MUKOZA. izlaze iz baze velikog mozga ili ulaze u njega.A. Na primjer. Štapići su osjetljivi na intenzitet svjetlosti. Tijekom razvitka iz zigote višestanični životinjski organizmi mitotičkim diobama povećavaju broj stanica koje se pomiču zauzimajući nove položaje (morfogenetska kretanja) i tako stvaraju nove oblike zametka. proces koji omogućuje stvaranje specifičnih razvojnih struktura i oblika kojima se odlikuje svaki organizam. MORFOLOGIJA. MORTALITET (smrtnost). sluz koju luče sporedne (mukozne) stanice gastričnih žlijezda. Nakon izlaska iz kralježnice. iRNA. tj. zelenu i crvenu). 5 pari križnih i 2 para trtičnih. čine ga međumozak. neurulu. treći unutarnji sloj očne jabučice. krvne grupe čovjeka određene su s tri alela . hodanje i sjedenje. Označuju se rimskim brojevima od I do XII. nalazi se na prijelazu srednjeg mozga u produženu moždinu. umanjena i obrnuta. brazdanje. motoričke i mješovite živce. Podijeljeni su u pet skupina: 8 pari vratnih. morfogeneza. zelene alge. moždani most i produžena moždina. između kralježaka. broj smrtnih slučajeva nekog područja u odnosu na cjelokupno stanovništvo. Sastoji se od fotoreceptora: štapića i čunjića. v. MOŽDANI MOST (pons). gastrulu. a njihovim podraživanjem doživljavamo sve boje u vidljivom dijelu spektra. a u vidnom središtu slika se uspravlja i usklađuje. v. mRNA (glasnička RNK ili gRNK. a čunjići na tri osnovne boje (modru. U njemu se nalaze živčana vlakna koja povezuju veliki i mali mozak. osjetilna i pokretačka živčana vlakna spajaju se u mješoviti živac koji ide prema periferiji tijela. znanost koja proučava izvanjsku građu tijela svih živih bića. više od dva alela gena. MULTIPLI ALELI. Inerviraju glavu. Kroz njega prolaze živčani putovi koji povezuju produženu leđnu moždinu s velikim mozgom. Slika predmeta koja se stvara na "žutoj pjegi" je realna. U mrežnici se svjetlosni podražaj (elektromagnetski valovi svjetla) fotokemijskim procesima u štapićima i čunjićima pretvara u živčani podražaj i očnim živcem odvodi u središte za vid u stražnjem režnju velikog mozga. tip ribonukleinske kiseline čija je uloga da na ribosom donosi informaciju o rasporedu dušičnih baza u molekulama DNA. Ima ih 12 pari. Mukoza oblaže želučanu stijenku kao obrana od razgradnje stijenke želuca pepsinom i kloridnom kiselinom. MORSKA SALATA. a prema funkcionalnim značajkama mogu se podijeliti na: osjetilne. v. 12 pari prsnih. MORFOGENEZA. MOŽDANI (mozgovni) ŽIVCI (nervi craniales). MOTORIČKI ŽIVČANI SUSTAV. MOŽDANO DEBLO.

nenamjerno izazvane nekim prirodnim fizičkim ili kemijskim faktorima i inducirane mutacije koje se namjerno izazivaju umjetnim putem. Prenose se spolnim načinom razmnožavanja. radijacije. No broj različitih alela u nekoj populaciji ili vrsti može biti veći. MUŠKI SPOLNI HORMONI. Mutacije se uvijek zbivaju pod određenim utjecajima. S obzirom na uzroke mutacija razlikujemo spontane mutacije. Među biljkama poznati je parazit potajnica. filogenetski sustav. akridinske boje. sjemenovoda i pomoćne spolne žlijezde prostate. patuljasti rast. dosjemenika ili pasjemenika. v. v. NASLJEDNA TVAR ili DNA. MUŠKI SPOLNI ORGANI. nasljedne iznenadne promjene u genomu. funkcije i razvoja stanice i cijelog organizma. manganovi spojevi. trakavice itd. MUTUALIZAM. te vanjskih organa: spolnog uda i mošnje. v. zapisana je redosljedom nukleotida u molekuli DNA. simbioza. To je uputa koja sadrži plan građe. formaldehid. a među životinjama metilji. Mutacije su stečene promjene koje je organizam stekao promjenom DNK. kompeticija. Na osnovi morfoloških ili kemijskih promjena kromosoma i gena razlikujemo tri vrste mutacija: 1. npr. androgeni. mutacije. Mutacija osigurava nasljednu promjenljivost (varijabilnost). NASLJEĐIVANJE. bakterije. Dođe li do promjena u rasplodnim stanicama ili u samoj zigoti tada se one prenose dalje na potomke. 93 . v. NANOSOMIJA. 3. Ona se prenosi s generacije na generaciju. v.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE mogu biti najviše dva različita alela. organizam ili stanica koja nosi mutaciju. nitriti. MUTACIJE (lat. proflavin itd). Mogu biti pozitivne i negativne. a ostvaruje se putem sinteze proteina. mutacije gena. MUTANTNI TIP. kemijskih tvari itd. a to su različita zračenja dovoljne energije koja mogu izazvati promjene (npr. mutacije građe kromosoma. NAMETNICI (paraziti). v. NASLJEDNA UPUTA. MUTAGENI FAKTORI. v. odnosno gena. Ako do promjena dođe u tjelesnim stanicama tada ih nazivamo somatske mutacije i one se ne nasljeđuju. mutare = mijenjati). NADMETANJE. proces prenošenja svojstava roditelja na potomke putem gena. Pozitivne su mutacije one koje će pomoći potomcima bolje snalaženje u okolišu od svojih roditelja nasuprot negativnih mutacija. NADP (nikotinamid-adenin-dinukleotidfosfat). organski spoj koji ima važnu ulogu u procesu fotosinteze kao prenosilac elektrona. MUREIN. sastoje se od unutarnjih organa: sjemenika. čime se zapravo omogućuje evolucija. Činitelji koji izazivaju mutacije nazivaju se mutageni faktori. UV i γ zrake) te različite tvari koje različitim mehanizmima također mogu izazvati promjene (peroksidi. N NADCARSTVO. mutacije broja kromosoma. biljni ili životinjski organizmi koji žive na ili u drugom organizmu (domadaru) hraneći se tvarima iz njihova tijela i to na štetu domadara. 2.

Oživljavanje pretpostavki što je dao Lamarck. haploidna generacija. Stanice koje čine stijenku nefrona upijaju (reapsorbiraju) veći dio tvari potrebnih tijelu iz filtrata (sva količina glukoze te znatne količine iona natrija. Kod beskralježnjaka nečisnicu imaju mužjaci nekih oblića. fosfata zatim aminokiseline i vode). žljezdano staničje. neandertalski pračovjek. v. u sramežljive mimoze. neki mekušci itd. osnovna građevna i funkcionalna jedinica bubrega. Dakle. broj rođenih (okoćenih) jedinki u jedinici vremena prema sveukupnom broju jedinki u populaciji. Razvija se međusobnom suradnjom dvaju zametnih listića: mezoderma i ektoderma. a dijelom rastenjem. Uzlazni krak ulijeva se u zajedničke sabirne kanaliće. a sekrecijom se oslobađaju iz tijela nepotrebne i štetna tvari (npr. NEANDERTALSKI PRAČOVJEK (neandertalac). v. NEURALNA PLOČA. ptica i sisavaca koji legu jaja. klora. kalija. silaznog i uzlaznog kraka koji su međusobno povezani suženom tzv. dodatak 5. Svaki bubreg sadrži milijun nefrona. reapsorbiraju u krvnožilni sustav sve potrebite tvari iz filtrata. kemonastije (izazvane kemijskim tvarima). novije evolucijske teorije koje su nastale poslije Darwina. NEKTON. NEČISNICA (kloaka). struktura koja nastaje tijekom embrionalnog razvoja kralježnjaka. termonastije (uzrokovane razlikom u temperaturi). NEODARVINIZAM. izumrli čovjekov predak čiji su prvi ostaci otkriveni u dolini Neandertalu blizu Dizeldorfa u Njemačkoj. NEOTENIJA. repaši. kao na pr. NATALITET. živčana stanica. v. zbog promjena turgora) i tigmonastije (savijanje vitica rezultat je promjene turgora). organomotorno gibanje biljnih organa čiji je smjer određen građom organa. NEANDERTALAC. ribe. glomerul. a ne smjerom iz kojeg dolazi podražaj. v. a smatraju da su selekcija. v. kod riba hrskavičnjača. koje su ogranci bubrežne odvodne arterije te kroz stijenke tih kapilara prebacuju se iz nefrona ponovno u krvotok. a temelje se na rastu. mozga i leđne moždine. mokraća i spolni produkti kod nekih životinja. NEKTAR. npr. NEURIT. pojava nastupanja spolne zrelosti i sposobnosti razmnožavanja prije završetka preobrazbe ličinke u odraslu jedinku. isp. Upijene tvari ulaze u kapilare. vodozemaca. NEFRON. NEOLAMARKIZAM. Neotenija omogućuje tim životinjama da nastave živjeti u vodi. NESPOLNA GENERACIJA (diploidna generacija). npr. koji se ulijevaju u bubrežnu čašicu. Razlikujemo: fotonastije (uzrokovano svjetlošću. nefroni obavljaju selektivnu filtraciju krvi. Uz neuralni žlijeb i neuralnu cijev predstavlja osnovu živčanog sustava. izolacija i aktivni izbor staništa glavni čimbenici evolucije. zajednički otvor kroz koji izlaze fekalije. Sastoji se od Bowmanove čahure. v. isp. kao npr. životinjski organizmi sposobni da se samostalno i aktivno kreću u vodi. ureja). mutacija. Henleovom petljom. žljezdano staničje. otvaranje cvjetova).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ NASTIJE. gmazova. Kroz silazni krak i petlju prolazi filtrat pod tlakom u uzlazni krak nefrona. 94 . vodika. seizmonastije (potaknute mahaničkim podražajima. Živio je prije 100 do 150 tisuća godina u razdoblju gornjeg pleistocena. shvaćanje da vrste evoluiraju pod učinkom raznih čimbenika sredine u kojoj organizmi žive. Većinom su uzrokovana reverzibilnim promjenama turgora. NEKTARIJ.

S. te ioni natrija ulaze iz izvanstanične tekućine u postsinaptički neuron. Inhibicijske neurohormone luče tzv. NADP. Neurohormon koji se vezao na receptore postsinaptičkog neurona biva razgrađen enzimom koji se oslobađa 95 . živčana stanica.J. koji mogu zakočiti prijenos informacije kroz sinapsu. Oni se neprestalno sintetiziraju u neuronima te se pohranjuju u mjehurićima završnih nožica (presinaptički neuron). NEUTROFILNI LEUKOCITI. jer ih fagocitiraju i razgrađuju u svojim vakuolama (fagosomima) pomoću probavnih enzima lizosoma fagocita. acetil-kolin. neurohormoni. G. NEUROTRANSMITERI. NIKOTINAMID-ADENIN-DINUKLEOTID-FOSFAT. živčane stanice koje na podražaj reagiraju stvaranjem i izlučivanjem hormona. NEUTROFILI. dopamin itd. v. tvari koje se izlučuju iz završnih dijelova aksona. Sinapsa Najučestaliji neurohormoni su acetil-holin. stanice hipotalamusa izlučuju faktore za oslobađanje gonadotropnih hormona koji potiču hipofizu na izlučivanje gonadotropnih hormona. v. nastao na prijemnom dijelu receptora stigne do završnih nožica. te će uz katione natrija u postsinaptički neuron ulaziti i anioni klora koji će poništiti pozitivan naboj uzrokovan ulaskom samo natrijskih kationa. v. npr. Oni uzrokuju otvaranje ionskih kanala za klor. noradrenalin. AcH). Tako. NEURON. v. iz presinaptičkog neurona (enzim za acetilkolin je acetil-kolin esteraza). Singer. uzrokuje naglo oslobađanje neurohormona iz mjehurića u sinaptičku pukotinu. tvari koje izlučuju stanice hipotalamusa i koje živčanim putem podražuju hipofizu te kontroliraju izlučivanje njenih hormona. Kada električni potencijal. koji uzrokuju prijenos podražaja podraživanjem postsinaptičkog neurona i inhibicijski (kočnički) neurohormoni (gama-aminomaslačna kiselina). NEUROSEKRECIJSKE STANICE. NICOLSON.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE NEUROHORMONI (neurotransmiteri).. leukociti. Neurohormon se veže na specifične membranske neurohormonske receptore sljedećeg neurona. inhibicijski neuroni iz završnih nožica.L. glavna su obrana protiv infekcije bakterijama. NEUROSEKRECIJSKI FAKTORI. Razlikujemo eksitacijske (podraživačke) neurohormone (noradrenalin. a vežu se na specifične receptore narednog neurona i kemijski ga podražuju. NEUTRALNE MASTI. v. neurosekrecijski faktori. NA. v. isto što i masti. Otvaraju se Na-kanali.

ribe) otvorile unutarnjim nosnim otvorima (hoane) u usnu šupljinu. denitrifikacija. v. dušikove bakterije. dušikove bakterije. Nosne su se šupljine (v. npr. ždralovke. On se oslobađa pri porastu tjelesnih potreba za kisikom. jedinka s mutantnim alelom koji nije izražen u fenotipu jer je uz njega prisutan dominantni alel. a oslobađa se i na živčanim završecima simpatičkih živčanih vlakana. Poznate su dvije vrste nukleinskih kiselina: dezoksiribonukleinska kiselina (DNA) i ribonukleinska kiselina (RNA). dušikove bakterije. šećera dez- 96 . a nitrite u nitrate dobivajući pri tom energiju potrebnu za sintezu organskih spojeva: 2NH3 + 3O2 → 2HNO2 + 2H2O + energija (bakterija Nitrosomonas) 2HNO2 → 2HNO3 + energija (bakterija Nitrobacter) Djelovanjem nekih anaerobnih bakterija moguć je i suprotan proces. To su npr. sove i šišmiši. v. DNA se nalazi u jezgri. v. korijenski gomoljići. NOSITELJ. Kasnije je otkriveno da su prisutne i u drugim dijelovima stanice. hormon kojeg luči srž nadbubrežne žlijezde. papigovke. životinje koje su noću aktivne. a u RNA šećer ribozu. svojstvo vezivanja atmosferskog dušika i prevođenje u nitrate i amonijak kojega imaju neke bakterije i modrozelene alge. NITROGENE BAKTERIJE. djetlovke i vrapčarke. NOKTURALNE ŽIVOTINJE. NUKLEIN. a RNA se. v. Nitrificirajuće bakterije oksidacijom prevode (oksidiraju) amonijak u nitrite. steljnjače. kisika (O) i dušika (N). naziv za kiselu tvar u staničnim jezgrama koju je otkrio znanstvenik Miescher čime je doprinio definiranju nukleinskih kiselina. NITROGENA FIKSACIJA. Neke od njih su: pingvinke. Razlika koja se uočava već u imenima nukleinskih kiselina je u tome što u sastavu DNA nalazimo šećer dezoksiribozu. Nukleotidi DNA ili dezoksiribonukleotidi se sastoje od fosfatne skupine. nocturnus = noćni). lat. nalazi i u citoplazmi. v. NOVOČELJUSKE (grebenke). NITRIFIKACIJA. osim u tim staničnim dijelovima. NIŽE BILJKE. ptice koje mogu letjeti jer imaju greben na prsnoj kosti. a nazvao ih je nukleinske kiseline jer ih je uočio u jezgrama stanica (lat. Tako je otvoren nosni put za udisanje zraka do pluća koja su se razvila od plivaćeg mjehura. noćne životinje. sokolovke.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ NITRIFICIRAJUĆE BAKTERIJE. golubovke. guščarice. kokoške. NOĆNE (nokturalne) ŽIVOTINJE (nokturna. v. mitohondrijima i plastidima. Dijele se na resoperke i dvodihalice. stara skupina riba važna za evoluciju kralježnjaka jer upućuju na prijelaz tih životinja iz vode na kopno. nucleus = jezgra). NORADRENALIN. genetička uputa. god. NODULI. Danas živi samo oko 10 vrsta nosnoprolaznica. NONSENSE CODE. Otkrio ih je švicarski znanstvenik Miescher 1869. NUKLEINSKE KISELINE. nitrofiksacija. NITROFIKSACIJA (nitrogena fiksacija). vodika (H). zbog povećanja tjelesne aktivnosti te povećava udarni volumen srca. Dijele se na dvadesetak skupina. NOSNOPROLAZNICE. složeni organski spojevi građeni od: ugljika (C). rodarice. v. Temeljne građevne jedinice nukleinskih kiselina su nukleotidi. proces obogaćivanja tla nitratima.

OBLIĆI. u sastavu ribosoma. životinje iz skupine oblenjaka. O OBLENJACI (Aschelminthes). NUKLEUS. gvanina. NUKLEOSOM. je kuglasto tijelo promjera oko 25 mm. NUKLEOPROTEINI. Molekulu DNA tvore dva polinukleotidna lanca obično spiralno uvijena. Tjelesna šupljina (pseudocel) je dobro razvijena.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE oksiriboze i jedne od četiriju dušičnih baza (adenina. Pojedini polipi u zadruzi nazivaju se hidranti. Spajanjem dvaju nukleotida nastaje dinukleotid. jednostavne oči. Najrasprostranjeni su oblići. ATP. OCELE. To su npr. a molekulu RNA jednostruki lanac koji sadrži manji broj nukleotida. NUKLEOLUS. osnovna građevna jedinica nukleinskih kiselina. Po funkciji odgovara jezgri odnosno kromosomu eukariotskih stanica jer predstavlja nasljednu tvar stanice. Najpoznatiji nametnički oblici su dječja glista i zavojita trihina. beskralješnjaci iz skupine beskolutićavaca. NUKLEOID. Nukleotidi RNA ili ribonukleotidi sadrže fosfatnu skupinu. OCTENO VRENJE. a mogu izmjenjivati generacije. šećer ribozu te također jednu od navedenih dušičnih baza s razlikom da se uvijek umjesto timina pojavljuje uracil. Svi obrubnjaci osim hidra su morski organizmi. žilnice i mrežnice. Nukleoproteini s DNA dolaze u sastavu jezgre (u kromosomima). Tijelo je pokriveno kutikulom. Većinom stvaraju zadruge. Vanjski dio očne jabučice sastoji se od tri koncentrična sloja tkiva: bjeloočnice. v. timina ili citozina). složeni organski spojevi građeni od nukleinskih kiselina (DNA ili RNA) i proteina. Imaju živčani sustav i osjetne organe. a više nukleotida polinukleotid. Uglavnom su razdvojenog spola. virnjaci. Poznato je više od 10000 vrsta. Probavilo je prohodno: imaju usni i crijevni (izmetni ili analni otvor). Nastanjuju mora i kopnene vode ili su nametnici. a u temelju je reakcija: C2H5OH + O2 → CH3COOH + H2O + + energija OČNA JABUČICA. isp. Nemaju sustav za optjecanje ni disanje (dišu preko kože). ili meduze. npr. osnovna je jedinica kromatina. jezgrica. šećera pentoze (šećer s pet C atoma) i fosforne kiseline. triju trinukleotid. OBRUBNJACI. postupak je pretvaranja alkohola u ocat uzrokovan aerobnim bakterijama. isp. NUKLEOZIDI. adenozin (adenin + riboza) i gvanozin (gvanin + riboza) kao derivati purinskih baza te citidin (citozin + riboza) i uridin (uracil + riboza) kao derivati pirimidinskih baza. NUKLEOTID. npr. 97 . okruglo tjelešce. Obrubnjaci žive kao polipi. jezgra. a nukleoproteini s RNA dolaze uglavnom u citoplazmi. životinje iz skupine žarnjaka. struktura koja se nalazi u sastavu prokariota. organske tvari nastale spajanjem purinskih ili pirimidinskih baza sa šećerima i to C-N vezom. v. Izgrađen je od dugačke molekule DNA zatvorene u prsten i gusto sklupčane. Sastavljen je od osam histonskih molekula koje su obavijene dvostrukom zavojnicom DNA. Organi za izlučivanje su protonefridiji. spoj triju molekula: purinskih ili pirimidinskih dušičnih baza.

osjetilo za vid. molekula hemoglobina koja prenosi vezani kisik. te tako ograničava rasprostranjenost vrste. kopnene i podzemne vode. a može uzrokovati smanjenje ili propadanje populacije organizama. u zatiljni dio mozga. Uzrokuje kontrakcije maternice pri porodu. To su. vežu s kisikom pri čemu nastaje voda i velika količina energije. abiotički ili biotički čimbenik koji se snažnije udaljuje od ekološkog optimuma ili pak prelazi granice ekološke valencije. reakcije oduzimanja vodika itd. reakcije spajanja s kisikom. ODRŽIVI RAZVOJ. oslobođeni u prethodnim reakcijama. obrve. isto što i prirodni odabir. OKSIDACIJA. proces nastajanja fosila zamjenom organske tvari (istrunulih dijelova organizma) anorganskom tvari: silikatima. razgradnja hranjivih tvari (ugljikohidrata. v. Oslobođeni atomi vodika se ne vežu izravno s kisikom nego atomi vodika postupno predaju elektrone nizu prenositelja (dišnih enzima) što omogućava i postupno oslobađanje energije koja se koristi za sintezu ATP-a. OGRANIČAVAJUĆI EKOLOŠKI ČIMBENIK. OKSITOCIN. trepavice. v. Neživu prirodu čine tlo. OKOŠTAVANJE. ODJELJAK.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ Unutarnjost je ispunjena staklastim tijelom (staklovinom). OKSIDACIJSKA FOSFORILACIJA. proizvodnja s minimalno štetnim učincima na biosferu. jedna od aerobnih faza staničnog disanja ili stanične respiracije koja se odvija u mitohondrijima. OKSIDACIJA HRANE. U toj fazi se atomi vodika. To je uleknuće na pelikuli ispunjeno crvenim pigmentom karotinom. Rastom koštanog tkiva upravlja parathormon kojeg luči doštitna žlijezda uz djelovanje vitamina D te iona kalcija i fosfata. lipida. OKO. suzne žlijezde. npr. suzno nosni kanal i mišići pokretači oka. OKSIGENIRANA KRV. npr. uzdušnice. inkrustacija. kao i os- 98 . Izlučivanje ovog hormona. v. Konačni produkti oksidacije hrane su ugljik(IV)-oksid i voda (isp. Receptorski potencijal koji je nastao u fotoreceptorima prenosi se vidnim živcem iz oba oka u vidnu regiju mozga. Glavni dijelovi oka su očna jabučica i očni živac. filogenetski sustav. mora. hormon koji izlučuje stražnji režanj hipofize (neurohipofiza). kemijska reakcija u kojoj neka molekula. a nakon poroda potiče sekreciju mlijeka iz dojke. stvaranje koštane mase tj. ODABIR. postupni prelazak hrskavičnog tkiva u koštano. mali i veliki optok krvi. disanje). ODUŠAK. karbonatima i dr. prirodno i kulturno okružje odnosno sve što čovjeka okružuje. v. organel za primanje svjetlosnih podražaja kod praživotinja. OKSIHEMOGLOBIN. To su mikroorganizmi. OČNA PJEGA (stigma). euglene. minerali. krv koja transportira kisik. Na taj se način energija pohranjuje u energetski bogatim vezama ATP-a. Minerali se mogu taložiti unutar skeleta ili na površini organizma. oceani. proteina) u stanici uz pomoć kisika pri čemu se oslobađa energija potrebna za životne aktivnosti stanice. atom ili ion otpušta ili gubi jedan ili više elektrona. životinje i ljudi kao predstavnici žive prirode. biljke. OKOLIŠ. Sastoji se od pomoćnih dijelova: gornji i donji kapci ili vjeđe. OKAMENJIVANJE (petrifikacija).

Sve tri polocite II propadaju čime je osigurana pohrana dovoljne količine hranjivih pričuvnih tvari u citoplazmi jedne jajne stanice. OLIGOSAHARIDI. Te tvari su potrebne za razvitak zametka u slučaju oplodnje jajne stanice. v.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE talih hormona hipofize. između ostalog. u riba i vodozemaca u vodi. OPARIN. Nakon mejoze I. Oplodnja može biti vanjska (izvan tijela ženke). zametne stanice u jajnicima s kojima započinje oogeneza (isp). je pod kontrolom podražaja iz hipotalamusa. Iz oocite II u procesu mejoze II nastaje jedna zrela jajna stanica i jedna sekundar- na polocita (polocita II). (1894. OPLODNJA (fertilizacija) KOD ČOVJEKA. OOGENEZA. Npr. ugljikohidrati. u sisavaca događa u jajovodu. OPLODNJA. npr. zigotu. OLIGOELEMENTI. Od jedne oogonije tijekom oogeneze nastaje. dijelovi složenih očiju kod kukaca i rakova. stražnji dio tijela (zadak) klještara iz skupine člankonožaca. v. gameta (spermija i jajne stanice) u zajedničku stanicu. organizmi koji uzimaju biljnu i životinjsku hranu. Unutarnja se oplodnja (u tijelu ženke). oogeneza. Ne nosi udove za hodanje. i jedna jajna stanica s haploidnim brojem kromosoma. Dolazi do promjena u sastavu biocenoza i poremećaja svih metaboličkih procesa. OLIGOSAPROBNE VODE.. rakovi. OLAKŠANA DIFUZIJA. pasivni prijenos.J. elementarni sastav. Dijele se mitozom pa imaju diploidan broj kromosoma. OLIGOPEPTIDI. fizioloških i biokemijskih osobina određenih skupina. temeljenih na samoregulaciji. OOGONIJE. otrova) u okoliš što dovodi do narušavanja ekosustava. iz svake pojedine oocite I nastaju dvije stanice: jedna sekundarna oocita (oocita II) i jedna primarna polocita (polocita I). npr. proces stapanja dviju različitih spolnih stanica. peptidi. ONEČIŠĆENJE OKOLIŠA. Spermij nosi u akrosomskoj kapi enzime (akrozin) za razgradnju obložnih stanica (Corona radiata) jajne stanice. jedan od stupnjeva onečišćenja voda. počinje stapanjem spermija i jajne stanice u prvoj trećini jajovoda.). Oocite II i polocita I sadrže haploidan broj kromosoma. skup morfoloških. Tako npr. prilikom naseljavanja kopna razvijala su se pluća. I jajna stanica i polocite II sadrže haploidan broj kromosoma. OPISTOMA. v. OMATIDIJE (okašca). Nakon prodora prvog spermija zona pellucida zadeblja te onemogućuje ulazak ostalim spermijima 99 . v. OOCITE. Započinje u doba puberteta kada iz zametnih stanica – oogonija nastaju velike nezrele stanice – primarne oocite (oocite I) koje sadrže diploidan broj kromosoma. ruski biokemičar koji je eksperimentirao s koacervatima. Nastao stapanjem 12 tjelesnih kolutića. – 1980. unošenje štetnih tvari (ksenobiotika. a označuje čiste vode. v. v. udovi za hodanje i pokrov tijela. OMNIVORI (raznojedni organizmi). proces nastajanja jajne stanice u jajnicima. A. OPĆA ADAPTACIJA (prilagodba). unos većih količina otpadnih razgradivih organskih tvari u jezerski ekosustav izazvati će bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima te nedostatak kisika u pridnenim slojevima. a iz polocite I nastaju dvije polocite II.

znanstvenik .ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ odnosno sprečava poliploidiju. OSJETILO ZA OKUS. te nakon nje organogeneza. Oko 7. Osjetni organi za okus su okusni pupoljci. OPTOK KRVI. spojevi koji izvorno nastaju u organizmima djelatnošću protoplazme. dana nakon implantacije postupno se razvija posteljica (placenta). OSJETILO ZA MIRIS (njuh).zoolog koji proučava ptice. etapa embrionalnog razvitka koju karakterizira postanak organa i organskih sustava. odnosno višestanični organizmi. proteini i nukleinske kiseline. a u pravilu i vodik. v. ORGANIZAM. nocireceptori. ORNITOLOG. U jajnoj stanici udružuju se haploidne predjezgre jajašca i spermija u zajedničku. Nakon mnogobrojnih brazdanja zigote nastaje blastocista koja se ugnježđuje (implantira) duboko u sluznicu maternice. ORGANELI. U organizacijskoj ljestvici živih bića organizam se nalazi između stanica. lipidi. ORGANOGENEZA. Podražaj primaju specijalizirani osjetilni neuroni koji na dendritima imaju posebna osjetilna tjelešca (receptore ili senzore). Oprašivanje kritosjemenjača zbiva se najčešće uz pomoć kukaca i vjetra. odnosno organa. ORGANSKI SPOJEVI. Podjelu vidi u tablici PODJELA RECEPTORA. Kod golosjemenjača se prenosi polen na mikropilu sjemenog zametka gotovo isključivo pomoću vjetra. Slijedi nakon gastrulacije kada se uzajamnim djelovanjem stanica triju zametnih listića (ektoderma. Na primjer. koji su na nižem stupnju ustroja i populacije koja je na višem stupnju. služi za primanje i prenošenje informacija. Svi organski spojevi obavezno sadrže ugljik. OSFRADIJ. Većinom se nalazi uz škrge. diploidnu jezgru oplođene stanice. zigotu. Nakon brazdanja slijedi druga faza zametnog razvoja . Osfradijem mekušci ispituju vodu koju koriste za disanje. Danas je poznato oko dva milijuna različitih biljnih i životinjskih organizama. U stanicama sluznice maternice nakupljaju se hranjive tvari. Građeni su od potpornih i receptorskih stanica iz kojih izlaze živčana vlakna koja se stapaju u živce što vode podražaje u 100 . prenošenje polena od muških na ženske dijelove cvijeta. a polenova zrna počinju klijati kada dospiju na njušku tučka. Postoji pet skupina osjetnih receptora: mehanoreceptori.gastrulacija. OSIKULE. Mogu se dobiti i u laboratoriju. mali i veliki optok krvi. sitne vapnene pločice različitih oblika kod trpova (bodljikaši) uložene u tjelesnu stijenku (kožu) i čine unutarnji kostur. isto što i stanični organeli. mezoderma i endoderma) počinju oblikovati budući organi. nalazi se na jeziku. receptori za njuh smješteni su u mirisnoj (olfaktornoj) regiji nosa u sluznici krovnog dijela gornjeg nosnog hodnika. termoreceptori. To su decidua stanice. Sluznica je puna žljezdanih stanica koje izlučuju sluz između kojih se nalazi od 10 milijuna do 20 milijuna mirisnih (olfaktornih) stanica s mirisnim dlačicama okrenutima prema nosnoj šupljini. elektromagnetski receptori i kemoreceptori. OPRAŠIVANJE. životna cjelina koju može izgraditi jedna ili više stanica pa ih stoga nazivamo jednostanični. uzajamnim djelovanjem ektoderma i mezoderma u kralježnjaka nastaje živčani sustav. osjetilo za njuh kod mekušaca. OSJETILNI ŽIVČANI SUSTAV (senzorički ili receptivni). Najvažniji organski spojevi u sastavu živih organizama su: ugljikohidrati.

mali i veliki mozak. Iz bazalnog dijela osjetilnih stanica izlaze ogranci vestibularnog živca koji prenosi receptorske potencijale u primozak. T i konstanti jednakoj plinskoj konstanti R.0 MPa (0.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE koru velikog mozga. Tako će i tlak biti dvostruko veći u otopini NaCl nego u otopini šećera iste koncentracije. za razliku od šećera. Ampule su proširenja polukružnih kanala i u njima se nalaze osjetilne stanice s dlačicama. tlak Meissnerovo Mehanoi Krauseovo receptori tjelešce i dr. Pacinijevo. Molekule vode se u otopini kreću niz gradijent kemijskog potencijala vode (koncentracijski gradijent ili vodni potencijal). dodir. tlak u otopini ili stanici koji raste s porastom množine (množinske koncentracije) otopljenih čestica. Cortijeve slluh stanice ravnopolukružni teža kanalići hladživčani noća završeci Termoreceptori živčani toplina završeci Nociživčani bol receptori završeci Elektroštapići i magnetski vid čunjići receptori okusni okus pupoljci mirisni miris receptori ugljikov produžena Kemodioksid moždina receptori aortna i kisik karotidna tjelešca alfa i beta st. Labirint se sastoji od: predvorja (vestibulum) s dva proširenja (utriculus i sacculus) i tri polukružna kanala.5 do 3. spužve. U dva proširenja predvorja nalaze se nakupina osjetilnih stanica s dlačicama . disocira na Na+ i Cl– što daje 2 mola/L čestica o kojima ovisi osmotski tlak. smješteno je u unutarnjem uhu u labirintu. slano (prednji dio iza područja za slatko). koja je za otapalo propusna (permeabilna). difuzija kroz polupropusnu membranu (opnu). OSMOZA. a za otopljenu tvar nepropusna. Na površini jezika nalaze se brojne okusne bradavice (papile). glukoza gušterače OSJETILO ZA RAVNOTEŽU. Osmoza se zbiva bez utroška energije. OSKULUM. odnosno iz područja više koncentracije vode (niža koncentracija otopljenih tvari) prema području niže koncentracije vode (viša koncentracija otopljenih tvari).makula. Tablica PODJELA RECEPTORA Skupina Osjet Receptori živčani završeci. ovisno o organu. a sa- 101 . mijenja od 0. Razlikujemo četiri osnovna okusa: slatko (na vrhu jezika). koje su najizraženije na korijenu jezika. Matemtički π = cRT Otopine koncentracije 1 mol/L šećera i 1 mol/L NaCl uz jednake uvjete nemaju isti osmostski tlak iako im je koncentracija ista jer NaCl. v. Osmotski se tlak stanice.1 MPa = 1 bar). OSMOTSKI TLAK (π ). a ovisan je o apsolutnoj temperaturi. Pojava osmoze vrlo je važna za funkcioniranje stanica jer se njihove stijenke sastoje od približno polupropusne mebrane. kiselo (duž rubova jezika) i gorko (na korijenu jezika).

u njemu se nespolno razmnožava. Voda može osmozom i ulaziti i izlaziti iz stanice. metilji). U fiziologiji bilja se umjesto kemijskog potencijala vode često upotrebljava naziv: vodni potencijal. a iz njih se razvijaju nove ličinke sa repićem (cerkarije). Životni ciklus se sastoji od nespolne i spolne faze. toksični elementi. jajnici. poredane su u krugu koštane stanice ili osteociti. OVČJI METILJ. Ovulacija se periodički ponavlja najčešće u razmacima od 28 dana. OSTEOPOROZA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ma stanica sadrži otopljnene tvari. Bolest se može usporiti terapijom tableta kalcija. Vrlo rahlo raspoređene parenhimske stanice s velikim pravilnim međustaničnim prostorom koji osim prozračivanju služe i lakšem plutanju biljnih organa nazivamo aerenhim. a nerijetko se stanice osnovnog tkiva preoblikuju u druga staničja. v. OVULACIJA. isp. Javlja se sa smanjenjem razine spolnih hormona. Ako nađe međudomadara puža malog barnjaka. Kosti postaju slabe i lomljive. koštane stanice. OSRČJE. provodi se radi lakšeg snalaženja u praćenju nasljeđivanja svojstava. v. Povezuje i učvrščuje sva ostala staničja. vrsta trajnog tkiva u biljaka koje čini najveći dio mase biljnog tijela. OZNAČAVANJE NASLJEDNIH FAKTORA I GENERACIJA. OTROVNOST (toksičnost). a u žena i spolnim hormonima. F2. v. Češ- ća je u žena (u postmenopauzi). OVARIJI. osobina neke kemijske tvari da može izazvati štetne. u probavilu se razvije u odrasli oblik. Oko Haversovog kanalića. Parenhimske stanice u listovima ispunjene su kloroplastima pa se zovu asimilacijski parenhim. a generacije potomaka (filijalne) prema redoslijedu s F1. srce. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. v. koštane stanice koje razaraju koštanu tvar stvorenu od osteoblasta. OSTEOBLASTI. Osnovno staničje služi i kao spremište pričuvne hrane pa ga zovemo spremišni parenhim. šećere itd. Stvaraju veliki broj jaja (hiperprodukcija potomaka). OSNOVNO STANIČJE (biljni parenhim). Cerkarije napuštaju puža i začahure se na barskoj biljci. kost. nametnik u žućovodu i jetri ovce (v. v. osnovno staničje. Kada ovca (prvi domadar) pojede travu s čahurom. soli. OSTEOCITI. npr. a u čovjeka se obično događa četrnaestog dana menstrualnog ciklusa. pojava izbacivanja zrele jajne stanice (jajašca) iz Graafovog folikula u trbušnu šupljinu. tvorne stanice koštanog tkiva. v. Osteoklasti su višejezgrene stanice koje se mogu ameboidalno pokretati. Bolest se naziva metiljavost. F3 itd. trpetljikava ličinka. Karakteristična je za sisavce. Rahlo osnovno staničje. a suvremena genetika je većim dijelom zadržala to označavanje. Ako se prati 102 . proizvode koštanu tvar. osnovna funkcionalna jedinica u kompaktnom sloju kosti. OSTEOKLASTI. transpiracijski parenhim služi izmjeni plinova. OSTEON. smanjenje gustoće koštanog tkiva (česta u starosti) zbog narušenog stvaranja organskog dijela kostiju. toksične učinke u organizmu. Nastaje mnogo ličinki (redije). vitamina D. Iz oplođenih jaja u vodi se razvija miracidij. Već je Mendel uveo označavanje nasljednih faktora i generacija simbolima (slovima). OSNOVNO TKIVO. OTROVNI ELEMENTI. kroz koji prolaze krvne žile i živci.

OZONSKE RUPE. umjetni elektrostimulator srca. da bi se jednostavnije i preglednije pokazalo koja svojstva roditelja nasljeđuju potomci. Ako se prate dva svojstva govori se o dihibridnom križanju. probavni enzimi gušterače. probavni enzimi gušterače. sloj plinovitog ozona na visini oko 40 km iznad površine tla. a za recesivni faktor malim. Iz izospora izraste protalij (haploidni gametofit). aB i ab. Tako. Test je negativan ako su sve stanice normalne. PAPRATI. a nakon oplodnje 103 . Listovi su im redovito veliki. stanjenje zemljine ozonske ovojnice tj. S donje strane nose soruse. a za drugo svojstvo B i b itd. Razmnožavaju se izmjenom spolne i nespolne generacije. Dodatak 1. sposobnost kore velikog mozga da pohranjuje neke podatke ili doživljaje. pipalo. v. Abc. primarno halogeniranih ugljikovodika (freona). PAPA TEST. a najčešće se označuju slovima i to za dominantni faktor (svojstvo) velikim. Koristi se za otkrivanje raka grla maternice i njegovih predstadija. v. npr. prate se sve moguće kombinacije njihovih gameta. Ono može biti trenutačno (samo nekoliko sekundi). U dihibridnom križanju s dominacijom jedinka genotipa AAbb dat će samo jednu vrstu gameta: Ab. biljke iz skupine papratnjača. za jedno svojstvo A i a. v. u monohibridnom križanju s dominacijom jedinka genotipa AA dat će jednu vrstu gameta: A. Za praćenje triju svojstava govori se o trihibridnom. a za praćenje više svojstava o polihibridnom križanju. PANKREASNA LIPAZA. PAKLARE. PALEONTOLOGIJA. PANKREATITIS. P PACEMAKER. v. a pozitivan ako su među stanicama grla maternice nalaze tumorske stanice. PANKREASNA AMILAZA. a jedinka genotipa AaBbcc dat će četiri vrste: ABc. smanjenje ozona u ozonosferi uglavnom zbog kemijskih spojeva koje proizvode ljudi. Rastu iz podzemne stabljike (podanka). a jedinka genotipa Aa dat će dvije vrste: A i a. Fiziološka osnova trenutačne i kratkotrajne memorije jest električna aktivnost skupine neurona mozga. PALP. ispitivanje stanica grla maternice bojenjem prema metodi Papanicolau. Na primjer. PANCREAS. gušterača. OZONSKA OVOJNICA. Ab. kružnouste. a jedinka genotipa AaBb dat će četiri vrste: AB. različitih oblika. v. Aleli pojedinih svojstava mogu se označavati na više načina.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE samo jedno svojstvo govori se o monohibridnom križanju. aBc i abc. kratkotrajno (do 3 dana) i dugotrajno (doživotno). Ako dominantnost nije izražena obično se svojstva označuju s a1 i a2. znanost koja se bavi proučavanjem ostataka izumrlih organizama (fosila). b1 i b2 itd. prizemni. upala gušterače. Ozon štiti Zemlju od štetnog ultraljubičastog zračenja. v. U trihibridnom križanju s dominacijom jedinka genotipa AABB CC dati će samo jednu vrstu gameta ABC. PAMĆENJE. Dugotrajno se pamćenje temelji na kemijskim promjenama koje nastaju nakon ponovljenog podraživanja skupine neurona mozga. U primjerima križanja. v.

Djelovanje parasimpatikusa je suprotno djelovanju simpatikusa. a važan je za regulaciju prometa kalcija u tijelu. stabljiku i list. hormon kojega izlučuju nuzštitne žlijezde. Dijele se na 104 .ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ razvije se iz embrija mlada paprat (diploidni sporofit). crvotočine i paprati. v. PARTENOGENEZA. PARENTALNO KRIŽANJE. osnovno staničje. razvitak zametka iz neoplođene jajne stanice. trajnice s podzemnom stabljikom (podankom) i s adventivnim korijenjem. Služe pri pokretanju. nametnici. npr. odrasla paprat mlada paprat sorusi sa sporangijama mejoza preslice. PARENHIMULA. v. PAPUČICA (Paramecium caudatum). Isp. trepetljikaši i praživotinje. Ljekovite paprati su oslad i slezenica. Za vrijeme oplodnje pokretnim spermatozoidima potrebna je voda. polušpiljama (gospin vlasak). dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa. križanje početne roditeljske (parentalne) generacije kojim nastaje prva generacija potomaka (filijalna) F1 generacija. spužve. npr. jelenak). prehrambeno neovisna o sporofitu. Spore su većinom istovrsne (izospore) pa im je gametofit jednodoman. PARAPATRIJSKA SPECIJACIJA. dok je gametofit nježna i mala biljčica. U hrvatskoj flori ima svega oko 50 vrsta paprati. Iz njih izlaze četine ili hete. specijacija. selaginela. Samo su neke papratnjače s različitim sporama te imaju dvodomni gametofit. specijacija kada se dvije populacije samo dotiču i tako imaju nepreklapajući prostorni kontakt. Paprati većinom žive u vlažnim tropskim krajevima ili kao epifiti. PARASIMPATIKUS. PARENHIM. prve prave kopnene biljke jer imaju korijen. Izumrle su drvenaste paprati. Vegetativno tijelo je snažni sporofit. PARAPODIJ (bataljica). v. ali i kod nekih riba. Do danas su se pojedine drvenaste papratnjače sačuvale kao fosili koje nalazimo u naslagama kamenog ugljena (geološko razdoblje karbon). embrio spore oplodnja arhegonij (jaje) anteridij (muška gameta) klijanje spore protalij sporofit (2n) gametofit (n) PAPRATNJAČE. PARAZITI. Naša najveća paprat je bujad (listovi dosegnu visinu i preko 2 m). ali je samostalna. koje su imale dvojake spore. v. Današnje papratnjače su zeljaste biljke. vodozemaca te nekih guštera. izdanak sa strane svakog kolutića kod mnogočetinaša. t. PARATHORMON. Na njima su i škrge. Partenogenezu susrećemo kod mnogih kukaca i drugih bezkralježnjaka.j. preci golosjemenjača. simpatikus ubrzava rad srca dok ga parasimpatikus usporava. Rastu u sjenovitim i vlažnim šumama (oslad.

Njima pripadaju pauci. Prirodnim putom protutijela prolaze kroz posteljicu iz majke u zametak. štipavci ili škorpioni i grinje. PATULJASTI RAST (nanosomija). životne zajednica koje žive u slobodnoj vodi i kreću se pasivno. tuberkuloza.. v. plućima ili mozgu čovjeka. PELAGIJAL. PAVLOV. gangrena. gonoreja. bakterije koje uzrokuju bolesti čovjeka. toksine.1885) prvi uporabio naziv virus označivši njime uzročnika te bolesti. a na zraku se stvrdne. PASJEMENIK (dosjemenik. Ikrice se razvijaju u jetri. pasivni prijenos. dio muškog spolnog sustava u kojem spermiji dozrijevaju i stječu sposobnost samostalnog kretanja. nastalih imunizacijom druge jedinke. PASIVNI PRIJENOS (pasivni transport). paučnjaci. Poznati su: pauk krstaš (križar) i crna udovica. tzv. životinja i biljaka izlučujući u organizam domaćina otrovne spojeve.).). PASIVNO STEČENA SPECIFIČNA IMUNOST. upala pluća. kolera. čovječji svrabac iz skupine šugaraca koji buši hodnike u pousmini kože i krpelji. epididymis). francuski mikrobiolog koji je otkrivajući cjepivo protiv bjesnoće (1881 . 105 . kvaščeve gljivice. najopasnija trakavica za čovjeka. guba. Uz pomoć prenositelja prolaze veće molekule. ali ne i njihovih spora. štipaljke. Ovaj prijenos se zasniva na procesu difuzije. Pauci imaju 2 -6 predljivih žlijezda na trbušnoj strani opistome. Teške bolesti koje uzrokuju bakterije u čovjeka su kuga. glukoze. PASTERIZACIJA. Velika je oko 5 mm i ima samo nekoliko proglotida. ruski psiholog. Po njemu se tzv. uvjetovani refleksi nazivaju Pavlovljevim refleksima. Umjetno izazvana imunost postiže se davanjem već gotovih protutijela. Kroz membranu se pasivno prenose manje molekule. aminokiselina itd. PAUCI. Pauci izlučuju produkte izmjene tvari pomoću Malpighijevih cjevčica. PAUČNJACI. Živi u crijevu psa. kasnije u djetinjstvu ili adolescenciji. PASIVNI TRANSPORT. ugljik(IV)-oksid. otkrio da se refleksi mogu izmijeniti učenjem. Paučinaste niti pauk plete stopalnim češljićem u mrežu. PEKARSKI KVASAC. voda. lebde (plankton) ili aktivno (nekton). isp. prijenos tvari kroz staničnu membranu iz područja veće koncentracije u područje manje koncentracije bez utroška energije s ili bez pomoći prenositelja. v. Za disanje imaju lepezaste uzdušnice. zagrijavanje supstrata na temperaturu oko 60 do 70 oC što dovodi do uništenja bakterija. npr. grabežljive životinje iz skupine klještari. sifilis. omogućena je unašanjem u organizam gotovih protutijela.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PASJA TRAKAVICA (ehinokok). difterija itd. npr. nastaje kad hipofiza ne stvara dovoljne količine hormona rasta. Može biti vidljivo kod rođenja. PEDICELARIJE. (1822. Škorpioni na kraju tijela imaju otrovnu bodlju. PATOGENE BAKTERIJE. urea itd. čovjeka ili životinje. (1848. Čovjek se može zaraziti dirajući zaraženog psa. PASTEUR. Razdvojenog su spola. Ženka paučinom zaprede oplođena jaja u kokon iz kojeg izlaze mladi slični odraslima. – 1895. Obični krpelj može biti prijenosnik virusnog encefalitisa i nekih nametničkih piroplazmi. U njima se stvara bjelančevinasta predljiva tvar koja izlazi kroz predljive bradavice. kisik. v. L. Ženka rađa žive mlade. člankonošci. tetanus. Nametnički oblici grinja su npr.-1936. I.

za što je dobio Nobelovu nagradu 1945. osnovno tijelo – kinetosom. tj. U Jadranu živi sredozemna medvjedica. srce. PERINUKLEARNI PROSTOR. nastaje kada karboksilna skupina jedne aminokiseline reagira s amino skupinom druge aminokiseline pri čemu se izdvaja molekula vode. Hrane se najčešće ribama. Udovi su se razvili u peraje. Kasnije se otkrilo da antibiotsko djelovanje imaju i druge tvari pa otuda i postojanje različitih antibiotika. v. Pentoze su npr. Aminokiseline se međusobno vežu peptidnim vezama. najpoznatija zelena plijesan sa sporangijskim nositeljima raspoređenih poput kista na čijim se ograncima razvijaju spore u nizovima. oprašivanje. Fleming 1929. tanka elastična opna koja obavija tijelo mnogih praživotinja. Sastoji se od dvije skupine živaca: moždani i moždinski živci. PENIS. Dijeli se na osjetilni i pokretački. grč. 106 . v. v. v. vezanjem 10 i manje aminokiselina nastaju oligopeptidi. pellicula.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PELIKULA (lat. PEPSINOGEN. PERIGON. PERIOST (pokosnica). Glavne stanice fundusnih i piloričkih žliježda že- luca luče inaktivni oblik enzima pepsinogen koji se aktivira uz prisutnost kloridne kiseline u pepsin. Kinetodezme i kinetosomi čine kinetički aparat. Općenito. Perajarima pripadaju tuljani i morski lavovi. Također sudjeluje u kretanju i uzimanju hrane te primanju podražaja iz okoliša. PEPTIDI. pelis = kožica). prašnik. Ima zaštitnu.ektoplazme. kost. PENICILIJUM. tj. triju tripeptid. Na osnovici je svake trepetljike bazalno. v. ukupne molekulske mase manje od 5000. PEPSIN. deoksiriboza i riboza.U papučice je sastavljena od niza alveolarnih mjehurića. tj. Pelikula je nastala spajanjem dvoslojne membrane i površinskog sloja tijela. papučice i bičaša. cvijet. prostor između dviju membrana jezgrine ovojnice. četiriju tetrapeptid itd. PEPTIDNA VEZA. H H R O N C C N H H H O C C OH R1 PERAJARI. npr. godine. pepsin. a najaktivniji je u jako kiseloj sredini (pH oko 2). PENICILIN. kemijski spojevi građeni od dvije do 20-40 vezanih aminokiselina. skupina sisavaca prilagođenih životu u vodi. provodi živčane impulse (informacije) u središte ili iz središta u izvršni organ. odnosno baktericidno zahvaljujući izlučivanju tvari penicilin. Penicillium notatum). a vezanjem više od 10 aminokiselina nastaju polipeptidi. Imaju obilježja zvijeri. v. PERIKARD. (kistac. PELUDNA ZRNA. penicilijum. v. najvažniji probavni enzim želuca. oprašivanje. a površinu pelikule prekrivaju trepetljike. enzim koji probavlja bjelančevine. djeluje antibakterijski. PERIFERNI ŽIVČANI SUSTAV. To djelovanje prvi je otkrio A. To je proteolitični enzim. Međusobno su kinetosomi povezani bjelančevinastim nitima – kinetodezmama koje provode podražaje. kloridna kiselina. v. Ima antibiotsko djelovanje. PELUD. konidiospore. prašnik. jednostavni šećeri ili monosaharidi s pet ugljikovih atoma u molekuli. spolni ud. PENTOZE. v. Vezanjem dviju aminokiselina nastaje nastaje dipeptid. pokrovnu i potpornu funkciju.

Svako pero ima badrljicu i zastavicu sastavljenu od isperaka. U živom organizmu pH – vrijednosti se uglavnom kreću u rasponu pH = 6 – 8 iako ima i izuzetaka npr. odnosno 7. PGTH (placentarni gonadotropni hormoni). vrsta dušičnih baza koje izgrađuju molekule DNA i RNA. način uzimanja hranjivih tvari u praživotinja. v. npr. potrebne za proces fotosinteze.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PERJE. v. PIVSKI KVASAC. pigmentum = boja). Kiseline povisuju. kvaščeve gljivice. u ljudskom želucu gdje je izrazito kisela sredina pH = 1. Isperci su međusobno povezani resicama. PIRIMIDINSKE BAZE. a kasnije iz posteljice. Sišu krv mno- gim kralješnjacima i beskralješnjacima. PJEVALO. ugljikov dioksid. Žive uglavnom u slatkim vodama. smjesom vode. Suzbija se bordoškom juhom. tvar koja daje boju tkivima ljudi. PIJAVICE. PLACENTARNI GONADOTROPNI HORMONI. životinja. endocitoza. U žena se placenta formira iz stanica trofoblasta i decidua stanica (stanice sluznice maternice) oko 16 dana nakon oplodnje jajne stanice. a ti hormoni spriječavaju menstruaciju koja bi uzrokovala gubitak ploda. 107 . modre galice i gašenog vapna. kytos = šupljina). hormoni koji se u ranoj fazi trudnoće izlučuju iz stanica trofoblasta. Kasnije u trudnoći estrogene i progesterone izlučuje sama posteljica. Uloga im je da sprečavaju propadanje žutog tijela nakon ovulacije te da ga potiču na izlučivanje povećane količine hormona estrogena i progesterona. embrionalni organ u većine sisavaca čija je uloga prehrana zametka odnosno ploda. oznaka za negativan logaritam koncentracije vodikovih iona. PINOCITOZA (grč. javanski pračovjek. Poznata vrsta je liječnička pijavica. Biljke stvaraju pigmente za apsorpciju sunčeve svjetlosne energije.pinosis = piti. PITEKANTROPUS. pH. organ kod ptica za proizvodnju glasova. PLAMENJAČA. Kroz posteljičnu opnu izmjenjuju se kisik. v. osobito kod ptica pjevica. isp. PERONOSPORA (plamenjača. Razlikuju se velika pokrovna pera i nježna perca pahuljice. životinje iz skupine kolutićavaca. biljaka i nekim bakterijama. pH = – log [H+]. Nemaju parapodija ni četina ali imaju prednju i stražnju prijanjalku. a na krilima su letna pera. tekuće hrane: otopljenih makromolekula kao što su bjelančevine ili aminokiseline. Sastavljeno je od sustava hrskavičnih i koštanih potpora i opni. nametnik na vinovoj lozi nanoseći velike štete. v. PIGMENT (lat. U sastavu DNA uvijek dolaze pirimidinske baze timin i citozin. dana nakon njenog “ukopavanja” (implantacije) u sluznicu maternice. Sastoji se od rožnate tvari keratina. PLACENTA (posteljica). gljiva algašica. hranjive i otpadne tvari između krvotoka majke i krvotoka ploda. Smješteno je na prijelazu iz dušnika u dušnice. a u sastavu RNA citozin i umjesto timina uracil. tvari koje povisuju tjelesnu temperaturu (mnogi toksini patogenih mikroorganizama). Što je viša koncentracija vodikovih iona to je niža vrijednost pH.5. peronospora. biljna bojila. Krvne i druge stanice ne mogu prolaziti kroz placentnu opnu. PGTH. Plasmopara viticola). v. Da se krv ne bi zgrušala slinske žlijezde izlučuju enzim hirudin. proizvod kože koji pokriva tijelo ptica i štiti od gubitka topline. a baze snizuju koncentraciju H+. PIRETICI (pirogene tvari).

u biljnoj stanici vanjski granični sloj plazme prema staničnoj stijenci. krvožilni sustav je na trbušnoj strani. PLAŠTENJACI (Tunicata).molekulu koja predstavlja male nizove gena (od 2 do 300) i pripadaju genomu stanice u kojoj se nalaze. Dio planktona kojega čine biljni organizmi nazivamo fitoplankton. a nespolno se razmnožavaju diobom u stanicama jetre i eritrocitima stvarajući truske koje se nazivaju merozoiti. Merozoiti se hrane hemoglobinom te uzrokuju raspadanje crvenih krvnih stanica popraćeno groznicom i visokom temperaturom. Tijelo im je obavijeno plaštem ili tunikom koji je izgrađen od tunicina. Zajedno s krvlju truske se raznesu kroz tijelo. PLAZMATSKA MEMBRANA. PLAZMODIJ. Imaju veliku sposobnost regeneracije. slezeni i jetri. U sastav fitoplanktona ulaze najčešće bičaši i alge kremenjašice. najčešće jednostaničnom tijelu. Uzastopnim dijeljenjem zigote nastaju truske koje putuju do žlijezda slinovnica komarca. kod žarnjaka ličinka obavijena trepetljikavim stanicama. PLANULA. Mješčićnice su dvospolci. Svaki plazmid sadržava jednu kratku. PLASTIDI. insekticidi te biološka metoda 108 . prednji dio probavila (ždrijelo) prorezan je škržnim pukotinama te ima ulogu i organa za disanje. PLAZMALEMA. bezlubanjci. Plazmidi imaju sposobnost samoumnožavanja i mogu se konjugacijom prenositi na druge bakterije. Najpoznatiji plaštenjaci su mješčićnice. Umjesto merozoita mogu se u eritrocitima razviti spolni oblici . gametociti dospiju u probavilo komarca i spoje se u pokretnu zigotu. Ovisno o vrsti plazmodija razlikujemo tropsku. Neke bakterije sadrže plazmide koji im daju otpornost na antibiotike. Te su izvankromosomske čestice DNA pronađene kod prokariota i eukariota. Nalazimo ih u limfnim čvorovima. biljni i životinjski organizmi koji lebde u morskoj vodi ili kopnenim vodama jer nemaju sposobnost samostalnog. Odrasli oblici su sjedilački. Kada komarac usiše krv zaraženog čovjeka. tercijarnu i kvartarnu malariju. isto što i stanična membrana. najprimitivniji svitkovci. Nakon uboda komarca sporozoiti ponovo zaraze zdravog čovjeka. aktivnog kretanja. male kružne molekule DNA koje mogu biti prisutne u citoplazmi stanice uz bakterijski "kromosom". Lebdenje u vodi im omogućuju razne izrasline i nastavci na njihovom. Najvažnija vrsta plastida su kloroplasti koji sadrže zeleni pigment klorofil.gametociti. nametnička praživotinja iz skupine truskovaca. a ličinka je plankton. Žive u moru. a dio kojega čine životinje zooplankton. a neke bakterije imaju plazmide koji im omogućuju korištenje dodatnih izvora hrane. PLAZMODEZMIJE. Razmnožavaju se nespolno (pupanjem) i spolno. citoplazmatski izdanci pomoću kojih se održava veza između dvije biljne stanice. spore (truske ili sporozoiti) se slinom komarca prenesu u krv čovjeka. stanični organeli biljnih stanica koji najčešće sadrže biljne boje (pigmente). a u sastav zooplanktona neki račići i različite ličinke i praživotinje. koštanoj moždini. zreli oblici limfocita B u kojima se stvaraju protutijela. Preventivne mjere suzbijanja razvoja komarca malaričara su: isušivanje močvara.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PLANKTON. Prenosnik plazmodija je komarac malaričar. Uzročnik malarije u čovjeka. "golu" dvolančanu DNA . Kada čovjeka ubode zaraženi komarac. živčana cijev je s leđne strane. Sličnosti s njima: imaju svitak (iako samo u zametnom i ličinačkom stadiju). PLAZMA-STANICE. PLAZMIDI.

isp. koji ima ulogu u disanju. Vakuola postaje sve manja i povlači okolni protoplast. isp. upala pluća. isp. alveolus = korito). izlazi iz desne klijetke srca. PLOD. bilateralno simetrični beskolutićavci. PLUĆA. Kod dvodihalica plivaći se mjehur razvio u pluća. šećera ili sl. lysis = razrješavanje). Živčani sustav je mrežast ili u obliku vrpci. PNEUMONIJA. ribe postaju teže od vode i tonu. lat. v. Pluća su građena od plućnih mjehurića ili alveola koje su okružene mrežom krvnih kapilara. generativni organ svojstven kritosjemenjačama. v. v. izmjenjuju preko kože. mali optok. Lijevo se sastoji od dva režnja. PLUĆNI OPTOK KRVI.hipoteze o postanku mnogostaničnih životinja.ptice.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE unašanja ribe gambuzije u močvare jer se ona hrani ličinkama komaraca. PNEUMATIČNE KOSTI. obavijeni su kapilarnom mrežom ogranaka plućne arterije. voda izlazi iz vakuole (mjesta veće koncentracije vode) u okolnu otopinu. metilje i trakavice. PLIVAĆI MJEHUR. tromboza. Za izlučivanje imaju protonefridije. kisik i ugljikov dioksid. ribe postaju lakše i dižu se prema površini. Također i fetus. PLUĆNA ARTERIJA. v. životinjski organizmi čija temperatura tijela ovisi uglavnom o temperaturi okoliša. koja je krvlju dopremila iz tijela ugljikov dioksid radi izmjene s kisikom. Svako plućno krilo obavijeno je poplućnicom ili pleurom. Sastoji se od sjemenki i usplođa koje se razvija iz plodnice. PLUĆNE VENE. Razvija se kao šuplji izdanak stijenke jednjaka. Usplođe štiti sjemenku i služi njihovu rasprostranjivanju. tučak. zatvarajući tako mali optok krvi. služi ribama iz skupine koštunjača kao hidrostatski organ. mali optok. Ispod pluća nalazi se ošit ili dijafragma. PLUĆNI MJEHURIĆI (alveole. Suprotan proces naziva se deplazmoliza. Tijelo im je ispod pokrovnog sustava ispunjeno parenhimom. krvna žila. plasma = tvorevina. koja povremeno preuzimaju funkciju pluća. Plinove. Tijelo im je splošteno s leđne i trbušne strane. krvne žile koje ulazi u lijevu pretklijetku srca. Poikilotermni organizmi su svi beskralje- 109 . mali optok krvi. stanice koje se mogu neograničeno reproducirati.. desno od tri režnja. slobodno plivajuća dvobočno simetrična ličinka kod bodljikaša. Nemaju nikakva kostura ni tjelesnih šupljina. isp. v. PLUTEUS. v. Oko 18500 vrsta ploš- njaka uključuje virnjake. Sastoje se od dva plućna krila. v. Kada je stanica u hipertoničnoj otopini soli. Na tu se kapilarnu mrežu nadovezuju venule i plućne vene koje oksigeniranu krv dovode u lijevu pretklijetku. PLAZMOLIZA (grč. v. PLOŠNJACI (Platodes). PLURIPOTENTNE STANICE. pravi sisavci. Žive slobodno ili kao nametnici. pojava smanjenja obujma vakuole i odvajanje protoplasta od stanične stijenke. Razlikujemo sočne i suhe plodove. PLODVAŠI. Kada se iz njega istisne plin. stabljika. Kada je napunjen plinom. PLODNICA. v. v. PODANAK. PLUĆNA EMBOLIJA. PLAZMODIJALNA TEORIJA O POSTANKU METAZOA. POIKILOTERMNI ORGANIZMI. organi za disanje kod čovjeka i drugih kopnenih kralježnjaka.

organski spoj iz skupine polinukleotida 110 .ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ žnjaci. POLENOVA ZRNA. v. v. skraćenica za poliuridilnu kiselinu. POLARIZACIJSKI MIKROSKOP. To su prirodna selekcija (odabiranje). v. a njegovo nastajanje određuje genetska uputa na mRNA koja se označava UUU UUU UUU ∼. a označava vrlo snažno onečišćene vode. pojava kada se čitava garnitura kromosoma povišestručuje. POLIPLOIDIJA. oprašivanje. POLEN. 2. a od kralježnjaka ribe. POLISAHARIDI. bolest povećanja broja crvenih krvnih stanica u perifernoj krvi. v. Ako se ta pojava ponovi broj kromosoma se opet udvostručuje. kemijski spoj građen od većeg broja molekula aminokiseline fenilalanina. nego svi kromosomi ostanu nagomilani u istoj stanici. proteini su izgrađeni od aminokiselina. prašnik. POLINUKLEOTIDI. mutacije i genska snaga. peptidi. POLIPEPTIDI. makromolekule izgrađene od manjih podjedinica monomera. genetska uputa koja nosi veliki broj uracil dušičnih baza i određuje ugradnju više molekula aminokiseline fenilalanina u proteinski lanac. npr. dječja paraliza. v. POLISAPROBNE VODE. v. dio je perifernog živčanog sustava. a udvostručiti se može i samo pola garniture. su velike molekule. POLI-U. POLIFENILALANIN. Tako umjesto diploidne 2ngarniture nastaju triploidi (3n). prašnik. POLISOMI. POKUS. POLIOMIJELITIS. POLITENI KROMOSOMI. v. POKRETAČKI (motorički) ŽIVČANI SUSTAV. POKROVNO TKIVO. Ova pojava je česta u biljaka. a polisaharidi od jednostavnih šećera. kost. Nastaje tijekom sinteze proteina. Na gornjoj strani valjkastog tijela je usni (oralni) otvor okružen lovkama. ličinka kod kružnousta. nukleotidi. a po funkciji se dijeli na voljni i autonomni. jedan od morfoloških oblika kod žarnjaka. POKRETAČKE SILE EVOLUCIJE. enzim koji kontrolira pravilnu ugradnju DNA nukleotida na matricu starog lanca DNA. POKOSNICA. 1. vodozemci i gmazovi. POLIURIDILNA KISELINA (poli-U). dječja paraliza. POLICITEMIJA. POLIP. ali se ne dijeli citoplazma ili ne funkcionira diobeno vreteno u mitozi. a vrlo je rijetka u životinja. gorostasni kromosomi. tetraploidi (4n). v. epitelno tkivo. jedan od stupnjeva onečišćenja voda. v. izolacija. mikroskop. pojave koje su omogućile razvoj i usavršavanje živih bića na Zemlji. 1. Poliploidne stanice nastaju tako da se udvostruče kromosomi. Jedan od uzroka je poremećaj regulacijskih mehanizama proizvodnje eritrocita u koštanoj moždini. POKAČA. POLIO. Živi sjedilački pričvršćen za dno. POLIMERI. polimeri i ugljikohidrati. v. nukleinske kiseline od nuk- leotida. pentaploidi (5n) itd. v. eksperiment. Mnogi polipi žive u zadrugama ili kolonijama. v. POLIMERAZA. nakupine ribosoma. oprašivanje.

v. POSTANAK VRSTA. žiroglavci. Osnovna jedinica poprečno prugastog mišićnog tkiva je mišićno vlakno izduženog cilindričnog oblika. v. miofibrili su poprečno isprugani.poplućnica. a međusobno su vezane prvenstveno odnosima razmnožavanja. posebice one s nabojem. 111 . v. Rasprostranjenost većine ljudske populacije ovisi o vegetaciji područja. POLUSVITKOVCI. POPREČNO-PRUGASTI MIŠIĆ. Porast količine tih hormona uzrokuje stezanje mišića maternice. neke od stanica koje su se prilagodile isključivo pružanju mehaničke čvrstoće biljnim organima. v. stanična membrana. kao i izlučivanje oksitocina. Potiču ga pokretačke sile evolucije: prirodna selekcija. ribozu i fosfatnu kiselinu. v. ali ne i velike molekule.placenta. ali njegov rad nije pod utjecajem naše volje. povremeno. izolacija i genska snaga. Ovojnica mišićnog vlakna zove se sarkolema. miofibrila. Tamne pruge sadrže i aktinske i miozinske filamente. Tijek poroda reguliraju hormoni. POLOVIČAN BROJ KROMOSOMA. Pojedini dijelovi miofibrila nejednako lome svjetlo pa pod mikroskopom vidimo izmjenično poredana svijetla i tamna polja. Poseban oblik poprečno prugastog mišićnog tkiva je srčano mišićno tkivo.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE nastao polimerizacijom samo jedne vrste nukleotida i to onog koji sadrži uracil. CO2). POTISNUTO SVOJSTVO. a unutarnjost je ispunjena sarkoplazmom u kojoj su pravilno uzdužno smješteni snopovi mišićnih vlakanaca. Razlog tome je raspored proteinskih filamenata (niti) aktina (tanji) i miozina (deblji) u samim miofibrilima. Vanjski list opne (porebrica) oblaže rebra s unutarnje strane prsnog koša. spontano izbacivanje sperme (naročito noću) zbog nakupljanja veće količine sperme u sjemenicima i sjemenim kanalićima. tanka dvolisna opna koja obavija svako plućno krilo. POPULACIJA. proces u prirodi koji se odvija dugotrajno i polagano. haploidan broj kromosoma. filogenetski sustav. POREBRICA. recesivno svojstvo. koje žive na istom prostoru. POLOCITE. v. Unutarnji list opne oblaže plućna krila. pa se neposredno prije poroda pojača izlučivanje hormona estrogena iznad vrijednosti koncentracije progesterona. sastoji se od mišićnog tkiva koje promatrano mikroskopom pokazuje poprečnu prugavost. POTPORNO STANIČJE. Rad ovog tkiva je pod utjecajem naše volje. PORODICA. POROĐAJ (porod). doba na kraju trudnoće u kojem dolazi do pravilnih ritmičkih stezanja i opuštanja mišića maternice što rezultira potiskivanjem ploda kroz porođajni kanal i izbacivanjem posteljice. različite životne dobi. Poprečno prugasto mišićno tkivo izgrađuje mišiće koji su tetivama vezani za kosti pa omogućuju pokretanje dijelova tijela. Najčešće se javlja u mladića u pubertetu. Mišićno vlakno ima veći broj jezgara koje su površinski smještene ispod sarkoleme. POSTELJICA . semipermeabilna ili probirno propusna (selektivno permeabilna) membrana. tj. Između obje poplućnice nalazi se malo tjelesne tekućine. a svijetle samo aktinske. POLUCIJA.). POPLUĆNICA ili pleura. Lako propušta vodu i male nenabijene molekule (npr. stanice koje nastaju za vrijeme oogeneze (isp. a rezultira nastajanjem novih bioloških vrsta. osmoza. POLUPROPUSNA MEMBRANA. skupina jedinki iste vrste. v.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

Dvije su vrste potpornog staničja: kolenhim, izgrađen od živih stanica i sklerenhim, izgrađen od mrtvih stanica. U mnogim biljkama te su stanice vrlo dugačke i elastične, a zovu se likovnice. POTRKUŠCI, mladunci nekih vrsta ptica (npr. kokoši, patke, guske, ždralova) koji se legu dobro razvijeni. Imaju otvorene oči, perje, mogu trčati i snalaziti se u prostoru. POTROŠAČI (konzumenti), heterotrofni organizmi koji se prema vrsti hrane koju troše dijele na: biljojede (fitofage, herbivore), mesojede (zoofage, karnivore) i saprofage. POUGLJENJIVANJE (karbonizacija), proces fosilizacije pod tlakom i bez prisutnosti kisika. Tako su npr.u karbonu procesom karbonizacije u vodama stajačicama (močvare, jezera) od dijelova papratnjača i drugih biljaka nastale velike naslage ugljena. POVEĆANJE MIKROSKOPA, omjer veličine slike promatranog predmeta i samog predmeta. Ukupno povećanje mikroskopa jednako je umnošku povećanja objektiva i okulara. Npr. ako je povećanje objektiva 40 puta, a okulara 10 puta ukupno povećanje bit će 400 puta. Svjetlosni mikroskop povećava najviše 1000 puta, a elektronski 400 000 puta. POVRATNA VEZA, isto što i mehanizam povratne sprege. POVRATNO KRIŽANJE, v. test križanje. PRAATMOSFERA, plinoviti omotač Zemlje u početku njenog nastanka, prije 4.5 do 4 milijarde godina. Smatra se da je praatmosfera sadržavala slobodan vodik (H2) i dušik (N2), metan (CH4), amonijak (NH3), cijanid ion (CN–), vodenu paru, okside ugljika (CO i CO2) i sumporovodik

(H2S). Stoga se smatra da se bitno razlikovala od današnje atmosfere jer nije sadržavala slobodan kisik (O2). PRABUBREG, v.drugi bubreg. PRACRIJEVO, v. arhenteron. PRAORGANIZMI (protobionti), prvi organizmi koji su se pojavili na Zemlji. O njihovom izgledu i načinu života danas postoje samo različite pretpostavke. PRAPTICA (Archaeopteryx), najpoznatiji i najtipičniji prijelazni oblik između gmazova i ptica. Živjela je krajem perioda jura, u mezozoiku. Bila je vrlo slična današnjim pticama (oblik tijela, perje, kljun, krila i dr.), ali je imala i mnogo obilježja gmazova od kojih potječu, kao npr. kralješke u repu, tri prsta s pandžama na repu, zube u kljunu. PRAŠNIK, muški dio cvijeta. Sastoji se od prašničke niti (filamenta) i prašnice (antere). U prašnicama se nalaze peludnice ili polenovnice (mikrosporangiji, muški sporangiji). Unutar polenovnica, iz diploidnih matičnih stanica, mejozom (redukcijskom diobom) nastaju četiri haploidne mikrospore (muške spore) koje zovemo polenova ili peludna zrna. Proces kojim nastaju mikrospore zove se mikrosporogeneza. Unutar polenovog zrna razvija se muški gametofit (haploidna generacija) s dvije muške gamete (spermalne, generativne jezgre tj. stanice) i jedne vegetativne stanice. PRAVI BUBREG, v. treći bubreg. PRAVI SISAVCI (plodvaši, placentalni sisavci), skupina životinja čiji se mladi razvijaju u maternici obavijeni plodvom, posteljicom ili placentom (ime!). Danas se razvrstavaju u dvadesetak skupina. Neke od njih su: šišmiši, kukcojedi, majmuni, glodavci, zvijeri, perajari, kitovi, slonovi, kopitari i papkari.

112

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PRAŽIVOTINJE (protozoa), jednostanične životinje, eukarioti, članovi carstva protista. Razvili su se tijekom evolucije iz prokariota. Mikroskopske su veličine. Najčešće žive samostalno ili kao zadružni oblici. Većinom su pokretni i heterotrofi. Žive u svim tipovima staništa: u moru i vodama na kopnu, a mnoge od njih su nametnici na drugim životinjama i na čovjeku. Na površini je protoplazmatskog tijela stanična membrana, pelikula ili čvrsta ljušturica. U protoplazmi se nalaze organeli koji obavljaju životne funkcije. Kreću se uz pomoć pseudopodija, bičeva i trepetljika. U nepovoljnim uvjetima često se začahure. Hranu uzimaju endocitozom, a kroz membrane hrana prolazi procesom difuzije. Probava se odvija u hranidbenim mjehurićima koji se kreću unutar organizma strujanjem citoplazme. Izmjena plinova, osmoregulacija i ekskrecija, također se obavljaju difuzijom kroz memebrane. Razmnožavaju se najčešće nespolno (diobom) i spolno. Poznato je oko 30.000 različitih vrsta praživotinja. Najpoznatije skupine su: bičaši, korjenonošci, trepetljikaši i truskovci. PREČNOUSTE, v. hrskavičnjače. PREDATORI (grabljivci), organizmi koji su u specifičnom odnosu ishrane s jedinkama druge vrste (predator-plijen), npr. ris je predator koji se hrani zečevima, lav je predator koji se hrani antilopama itd. PREDBUBREG, v.prvi bubreg. PREDLJIVE BRADAVICE, v. paučnjaci. PREHLADA, najčešća bolest dišnog sustava koju uzrokuju različiti virusi. Najčešće su inficirani gornji dišni putovi: nos i grlo. Simptomi su kihanje, suzenje, grlobolja, promuklost, kašalj i curenje iz nosa. Rijetko traje dulje od tjedan dana.

PREDMENSTRUACIJSKI SINDROM (PMS), skup različitih simptoma (fizičkih i psihičkih) koji se javljaju u mnogih žena prije mjesečnice. Uzrok tim promjenama je stalna izmjena koncentracije estrogena i progesterona za vrijeme menstruacijskog ciklusa. PREMOSNICA (engl. by-pass), dio vene uzet iz bedra s pomoću koje se operativno premošćuju oboljele koronarne arterije radi optimalnog opskrbljivanja srčanog mišića kisikom i hranjivim tvarima. PREMOSNICI, stara skupina gmazova. Jedini živi predstavnik i živi fosil je pilasti premosnik, jer se gotovo ništa nije promijenio već 150 milijuna godina . Danas živi uz obalu Novog Zelanda. Duž leđa ima pilasti greben od trokutastih ljusaka. Na glavi se nalazi tjemeno oko. PREOBRAZBA (metamorfoza) proces promjene oblika tijela. Neke životinje tijekom razvoja i rasta podliježu velikim promjenama, npr. kod beskralježnjaka kukci, isp., a kod kralježnjaka vodozemci, isp. punoglavac. PREPISIVANJE, v. sinteza proteina. PRESLICE, biljke iz skupine papratnjača. Poznata je poljska preslica. Zelena je stabljika člankovita i pršljenasto razgranata. Listovi su sitni i neugledni te obavijaju stabljiku iznad svakog koljenca. U rano proljeće uočavaju se smeđe nerazgranate stabljike koje na vrhu nose češerić sa sporangijima i sporama. Izospore su prilagođene raznošenju vjetrom pomoću haptera. PRETILOST (gojaznost, adipoznost), porast tjelesne mase uvjetovan nakupljanjem masti, koje nastaje zbog viška uzete hrane. Višak masnog tkiva posebno opterećuje srce i krvotok. Povećava se i rizik pojave različitih bolesti (ateroskleroza, hipertenzija, infarkt, bolesti jetre, šećerna bolest i dr.).

113

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PRETVORBA ENERGIJE, proces kad se svjetlosna, električna, toplinska, kemijska i mehanička energija pretvaraju jedna u drugu jer se energija ne može ni stvoriti ni razoriti. PREVOĐENJE, v. sinteza proteina. PRIČVRSNICA (centromera), mjesto suženja na kromosomu za koje se prihvaćaju niti diobenog vretena tijekom diobe stanice. PRIDOŠLO KORIJENJE, v. korijen. PRIJELAZNI OBLICI, organizmi koji su po nekim svojim obilježjima na prijelazu između velikih razvojnih skupina. Na primjer, izumrle biljke pteridosperme, napola paprati napola sjemenjače, fosilna praptica s nekim osobinama gmazova, čudnovati kljunaš koji sjedinjuje obilježja gmazova, ptica i sisavaca, štitoglavac sejmurija bio je prijelazni oblik između vodozemaca i gmazova. itd. PRIJENOSNA RNK, v. tRNA. PRILAGODBA (adaptacija), osobina organizma kao konačna posljedica selekcijskog procesa. Oni oblici koji su najbolje prilagođeni uvjetima okoliša imaju izgleda za daljnji razvoj i množenje, a time i za održavanje svoje vrste u tom okolišu. Poznate su opće i specijalne adaptacije, isp. PRIMARNA IMUNOLOŠKA REAKCIJA, v.imuna memorija. PRIMARNA ORGANSKA PROIZVODNJA (primarna bioproizvodnja), proces stvaranja organske tvari iz anorganskih koji se odvija u autotrofnim organizmima, isp. autotrofi. Bioproizvodnost ekosustava ovisi o hranjivim i mineralnim tvarima, Sunčevoj energiji, toplini i dr. Od kopnenih ekosustava najproduktivnije su šume, a od vodenih ekosustava najveća je bioproizvodnja u zapadnom Atlantiku.

PRIMARNE SPERMATOCITE, stanice koje nastaju za vrijeme spermatogeneze (isp.). PRIMARNI RAST BILJAKA, rast biljaka u dužinu pomoću vršnih meristema izdanka i korijena. PRIMATI, najsavršenija skupina sisavaca kojoj pripadaju polumajmuni, majmuni, a sa zoološkog gledišta i čovjek. PRIONI, sitne zarazne čestice (manje od virusa i viroida) koje uzrokuju bolesti u čovjeka i životinja (kravlje ludilo). Otkriveni su 1980. god. Veliki su 2 do 3 nm, a građeni su samo od proteina. PRIRODNI ODABIR (selekcija, selekcijski pritisak), po Darwinu, glavni čimbenik evolucije koji uvjetuje stalno povećavanje prilagođenosti organizama životnoj sredini. Preživljavaju samo najbolje prilagođene jedinke, v. prilagođavanje. Za razliku od prirodnog odabira umjetni odabir nastaje djelovanjem čovjeka pri čemu se korisni oblici održavaju, a nekorisni propadaju. PRIRODNI SUSTAV, v. filogenetski (prirodni) sustav. PRIROĐENA IMUNOST (nespecifična), otpornost organizma na različite antigene, koja je prisutna u tijelu od rođenja bez posebnih oblika pokretanja imunološke reakcije. Nositelji te vrste imunosti su fagociti, neutrofilni leukociti i monociti. PROBAVA, proces razgradnje hrane u sastojke koji se mogu upiti u krv ili limfu ili nekim drugim načinom prenijeti do stanica. Razlikujemo intracelularnu i ekstracelularnu probavu. PROBAVNI ENZIM, v. pepsin. PROBAVNI ENZIMI GUŠTERAČE, probavljaju ugljikohidrate, bjelančevine i masti. Enzim za razlaganje ugljikohidrata

114

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

je pankreasna amilaza koja hidrolizira škrob i glikogen (ne i celulozu!) do disaharida. Proteolitični su enzimi: tripsin, kimotripsin, karboksipolipeptidaze i (deoksi) ribonukleaze. Pankreasna lipaza hidrolizira neutralne masti u glicerol i masne kiseline. Enzimatski učinak lipaze na masti pospješuje se djelovanjem žuči koja uzrokuje raspršivanje masti u male kapljice (hilomikrone). PROBAVNI SUSTAV, proteže se gotovo duž čitave dužine tijela kao probavna cijev - od usta do analnog otvora. Sastavljen je od niza probavnih organa i probavnih žlijezda s izlučivanjem (sekrecijom) probavnih sokova u probavilo. To su npr. kod čovjeka: usna šupljina sa zubima i jezikom, ždrijelo, jednjak, želudac, tanko i debelo crijevo te žlijezde slinovnice, gušterača i jetra. PRODUCENTI, proizvođači hrane u prirodi, zelene biljke. PRODUŽENA MOŽDINA (medulla oblongata), smještena je ispod velikog i ispred malog mozga. Završava kod velikog zatiljnog otvora, odakle se dalje u kralježnicu nastavlja leđna moždina. Produžena moždina je građena od vanjske bijele i unutarnje sive tvari. Regulira vegetativne funkcije, kao što su: disanje, krvni tlak, peristaltika crijeva i dr. Oštećenjem produžena moždine, npr. središta za disanje, nastupa smrt. PROFAZA DRUGE MEJOTIČKE DIOBE, v. profaza II. PROFAZA I (profaza prve mejotičke diobe), početna faza redukcijske diobe, mejoze I. U toj fazi dolazi do sparivanja, tj. konjugacije homolognih kromosoma. Parove tako sparenih kromosoma nazivamo bivalenti, a kako je svaki kromosom dvostruk (sastoji se od dvije kromatide), spareni kromosomi tvore snopove od četiri

kromatide koje nazivamo kromosomske tetrade. Tijekom konjugacije kromosoma česta je pojava ispreplitanja njihovih kromatida, a mjesta ispreplitanja nazivamo hijazme. Na hijazmama može doći do pucanja i izmjenjivanja kromatida homolognih kromosoma. Tu pojavu nazivamo krosingover (crossing over). Ona je važna jer doprinosi genetičkoj raznolikosti stanica koje nastaju mejozom. PROFAZA II, (profaza druge mejotičke diobe), jedna od etapa mejoze II u kojoj su zbivanja slična zbivanjima u profazi mitoze. U profazi II razgrađuje se jezgrina ovojnica i jezgrica, a kromosomi se počinju spiralizirati. Centrosom se podijeli na dva dijela koja putuju na suprotne polove stanice formirajući diobeno vreteno. Za razliku od stanica koje ulaze u profazu mitoze i imaju dvostruki (2n) broj kromosoma, stanice koje ulaze u profazu II imaju jednostruk (n) broj kromosoma. PROFAZA PRVE MEJOTIČKE DIOBE, v. profaza I. PROFAZA, početna faza diobe stanice, mitoze. U njoj se kromosomi počinju spiralizirati i tako postaju vidljivi. U toj fazi gubi se jezgrina ovojnica i jezgrica, a centrosom se podijeli na dva dijela koji putuju na suprotne polove stanice formirajući diobeno vreteno. PROGESTERON, jedan od ženskih spolnih hormona kojega izlučuju ženske spolne žlijezde, jajnici. U pubertetu progesteron utječe na razvoj spolnih karakteristika i pojavu menstruacijskog ciklusa. Tijekom menstruacijskog ciklusa izlučuje ga i tvorba nazvana žuto tijelo. U trudnoći ga izlučuje i posteljica. Uloga progesterona tijekom trudnoće je sprečavanje menstruacije koja bi uzrokovala gubitak ploda. PROGLOTIDI, v. trakavica.

115

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PROKARIOTI, (prokariotski organizmi), jednostanični organizmi koji nemaju oblikovanu jezgru ni stanične organele kao što su mitohondriji, plastidi i Golgijevo tijelo, ali imaju ribosome i umjesto jezgre nukleoid. Prokarioti su bakterije i modrozelene alge (cijanobakterije). Pošto su prokarioti jednostanični organizmi, njihov opis ujedno predstavlja i opis prokariotskih stanica. Dio znanstvenika ih ne ubraja ni u biljke ni u životinje, već u zasebno carstvo pod imenom Monere. PROKARIOTSKE STANICE (protocite, grč. pro = prije, karyon = jezgra), prijejezgrene stanice, v. prokarioti. PROKARIOTSKI prokarioti. ORGANIZMI, v.

PROPLIOPITEKUS (Propliopithecus), vrsta pramajmuna koja je živjela u razdoblju oligocena, dakle prije 25 do 30 milijuna godina. PROSOMA, prednji dio tijela (glavopršnjak) klještara iz skupine člankonožaca. Nastao stapanjem 8 tjelesnih kolutića. Na prosomi je pet pari nogu: četiri služe za hodanje, a prvi par je promijenjen u čeljusne nožice za pridržavanje plijena ili kao osjetilo. Uz usta su kliješta ili helicere, isp. PROSTATA, žlijezda koja je dio muškog spolnog sustava. Izlučuje lužnate sekrete koji neutraliziraju kiselost sperme. PROTALIJ, malena višestanična tvorevina krpastog, srcolikog ili gomoljastog oblika koja se razvija iz proklijale spore papratnjača. Na protaliju se razvijaju spolni organi (anteridiji i arhegoniji) pa je prema tome, protalij dio spolne generacije (gametofita). PROTEINI (bjelančevine), složene organske molekule građene od aminokiselina koje su međusobno povezane peptidnim vezama. U građi proteina živih bića dolazi 20 različitih aminokiselina. Proteini u živim bićima imaju strukturnu ulogu, nositelji su biokemijskih procesa u organizmu (npr. hormoni, enzimi), a u manjoj mjeri koriste se kao izvor energije. PROTEINOIDI, tvari slične proteinima koje je zagrijavanjem aminokiselina suhim postupkom dobio znanstvenik Fox. Kada ih je otapao u vrućoj morskoj vodi proteinoidi su se pretvarali u okrugla tjelešca (mikrosfere) slična jednostavnim živim stanicama. PROTEINURIJA, pojava bjelančevina u mokraći kod nekih bubrežnih bolesti. PROTEOLITIČKI ENZIM, v. probavni enzimi gušterače.

PROKLIČNICA (protonema), malena nitasta tvorevina slična steljci koja se razvija u većine mahovina iz proklijale spore. Iz prokličnice se razvije mahovina koja nosi na sebi spolne organe (anteridije i arhegonije) pa je prema tome, prokličnica dio spolne generacije (gametofita). PROLAKTIN, hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a uloga mu je da dan-dva nakon porođaja izaziva izlučivanje mlijeka iz žljezdanih stanica dojke. PROLIN, kemijski spoj iz skupine aminokiselina. PRONEFROS, v. prvi bubreg. PROPLASTIDI, stanični organeli, ubrajamo ih u skupinu staničnih organela čiji je zajednički naziv plastidi (isp.). Proplastidi su ishodišni oblik plastida iz kojeg se mogu razviti svi ostali tipovi plastida: kloroplasti, kromoplasti, leukoplasti. Nalaze se u embrionalnim stanicama npr. stanice vegetacijskog vrška. Obavijeni su dvostrukom membranom. Iz unutarnje membrane uvrtanjem nastaju tilakoidne membrane.

116

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PROTISTI, svi jednostanični organizmi od kojih su neki svojim osobinama slični biljkama (fotosintetski autotrofni producenti), neki životinjama (heterotrofni potrošači, konzumenti), a neki gljivama (heterotrofni razgrađivači). PROTOBIONTI, v. praorganizmi. PROTOCITE, v. prokariotske stanice. PROTONEFRIDIJI, organi za izlučivanje i osmoreglaciju kod mnogih beskolutićavaca (npr. plošnjaka i oblića). Sastoje se od sustava cjevčica smještenih u parenhimu. Svaka cjevčica završava tjemenom stanicom kroz čiju se membranu apsorbiraju produkti metabolizma i odvode van. Cjevčice se na površini tijela otvaraju malim otvorom - porom. PROTONEMA, v. prokličnica. PROTOPLAZMA, živa tvar stanice koju čine jezgra i sadržaj citoplazme. PROTOZOA, v. praživotinje. PROTUŠIFRA, v. antikodon. PROTUTIJELA, v. antitijela. PROVODNI (karakteristični) FOSILI, fosilni ostaci organizama koji se smatraju karakterističnim za određeno razdoblje Zemljine prošlosti. Važni su za prosudbu kakav je bio živi svijet pojedinih geoloških razdoblja i za određivanje njihove relativne starosti. Tako su primjerice nalazi trilobita, izumrlih člankonožaca karakteristični za slojeve starog paleozoika; nalazi amonita, izumrlih glavonožaca upućuju na mezozoik; nalazi školjke kongerije karakteristični su za slojeve tercijara. PROVODNO STANIČJE, oblikuje provodne žile koje sežu u sve dijelove biljke. Provođenje vode i otopljenih minerala odvija se putem dijela žile koji se zove ksilem. U golosjemenjača to su vrlo duge

stanice koje se zovu traheide. Ksilem kritosjemenjača čine traheje, duge cijevi nastale od niza produžnih stanica kojima su reducirane poprečne mebrane. Ksilemski su elementi čvrste stanice odebljalih, ligniziranih (odrvenjenih) stijenki koji daju i potrebnu čvrstoću žili što je važno za njezin rad. U jednogodišnjih biljki, ali i višegodišnjih tijekom njihove prve godine ti ksilemski dijelovi žile daju čvrstoću čitavoj biljki. U višegodišnjih drvenastih biljaka ksilemski elementi preuzimaju postupno samo ulogu održanja čvrstoće i izgrađuju dio stabla koji zovemo drvo. Drugim dijelom žile, floemom provode se organske tvari od listova u sve biljne dijelove. PRVA MEJOTIČKA DIOBA, v. mejoza I. PRVI BUBREG (predbubreg ili pronefros), organ za izlučivanje samo kod kružnousta i ličinke riba. Kod ostalih skupina kralježnjaka zakržlja u njihovu zametnom razvitku. Sastavljen je od tri para cjevčica sa trepetljikavim lijevcima ispred kojih je klupko krvnih žila (glomerul). Iz njih se krv filtrira u zajednički izvodni kanal, predbubrežnu cijev. PRVI VIŠESTANIČNI ORGANIZMI, organizmi koji su nastali tijekom biološke evolucije prije 600 do 700 milijuna godina. Njihov razvoj započeo je u vodi. PSEUDOCEL, tjelesna šupljina koja po postanku odgovara primarnoj tjelesnoj šupljini ili blastocelu, isp. blastula. PSEUDOPODIJI (lažne nožice, grč. pseudos = laž, podos = noga), izdanci u praživotinja (npr. amebe) koji služe za pokretanje i uzimanje hrane procesom endocitoze. Nastaju kao posljedica strujanja protoplazme (endoplazme prema ektoplazmi ili egzoplazmi) i mijenjanja fizikalnog stanja citoplazme (sol i gel stanje).

117

Snesena ptičja jaja trebaju za zametni razvitak inkubaciju . Ptice se hrane zrnjem a mnoge su mesojedi. odnosno ženskih spolnih hormona (estrogen. Puči se otvaraju kada u njima poraste turgor (u odnosu prema susjedicama) zbog primanja vode u zapornice. a kod dječaka polucija. a fotosin- 118 . Ptice imaju dobar sluh i izvrstan vid. Mogu se smatrati prijelaznim oblicima između papratnjača i golosjemenjača. a stražnji noge za hodanje. PTICE (Aves). oni su potrkušci ili čučavci. Ptice pokazuju raznolike oblike pojedinačnog i zadružnog ponašanja kao npr. alantois i seroza. mikroskopski otvori u epidermi. Danas u biosferi živi oko 8600. koje su na vrhovima listova umjesto sporangija nosile sjemenke. Najstarija poznata vrsta je jurska ptica. Sve ptice legu jaja. prve papratnjače. treći bubreg). t. Lučenje GTH nadzire hipotalamus gdje se. Toplokrvnost i sposobnost da lete omogućili su pticama široku rasprostranjenost na Zemlji. Probavu olakšava volja i žljezdani želudac gdje se hrana razgrađuje enzimima. Pubertat započinje u djevojčica oko 10. Nemaju mokraćni mjehur.zagrijavanje ležanjem roditelja na njima. Današnje se ptice dijele u dvije skupine: staročeljuske ili bezgrebenke i novočeljuske ili grebenke. godine. leženje na jajima. praptica ili Archaeopteryx. v. Za izlučivanje imaju jedan par pravih bubrega (v. Srce je sastavljeno od dvije pretklijetke i dvije klijetke. luče neurohormonske tvari za oslobađanje gonadotropnih hormona. kada u stanice zapornice ulaze kalijevi ioni. Kod djevojčica se javlja menarha. U mišićnom se želucu hrana usitnjava mehanički. a sudjeluje u razgradnji škroba do šećera maltoze i glukoze. Oplodnja je unutarnja. počevši od puberteta. skupina kralježnjaka koja se potpuno prilagodila životu na kopnu. a u dječaka jednu do dvije godina kasnije. Traje nekoliko godina. Pluća su povezana sa pet pari zračnih vrećica koja zalaze među organe i u kosti. Ptice su važne kako za čovjeka tako i u održavanju prirodne ravnoteže.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PSILOFITI (grč. drevne izumrle biljke nalik na papratnjače. koje su imale samo zelenu. golu i vitičasto razgranatu stabljiku bez listova. kroz koje se izmjenjuju plinovi između okoliša i unutarnjosti biljke te izlučuje voda. a u Hrvatskoj oko 250 vrsta. Površinska je ovojnica tvrda lupina ili ljuska. Kad se iz jajeta izlegu mladunci. i 18. najčešće na naličju listova. probavni enzim koji se nalazi u sastavu sline. Ptice su se razvile od pragmazova. Puči okružuju dvije stanice zapornice uz koje se nalaze mnogo veće stanice susjedice. "paprati sa sjemenkama". isp. Tijelo im je pokriveno perjem. život u jatima i seobe. najčešće s 4 prsta. Osim fizičkih promjena u pubertetu se pojavljuje niz fizioloških i psihičkih promjena. Mnoge kosti su šuplje i ispunjene zrakom tzv. isp. Za vrijeme prolaska kroz jajovod jaja se obavijaju ovojnicama. phiton = biljka). PUBERTET (spolno sazrijevanje). Imaju dva para udova: prednji par su krila. progesteron) iskazuju se primarne i sekundarne spolne oznake. do 13. briga za podmladak. Na glavi je kljun s ustima bez zuba. Ženke imaju samo lijevi jajnik i jajovod. Razlikuju boje. PUČI (stome). PTIJALIN (alfa amilaza). Mužjaci prenose sjeme izravno u nečisnicu. Prsna kost ima greben za koji se drže prsni (letni) mišići. godine. Oko zametka se stvaraju zametne ovojnice: amnion. gradnja gnijezda. Naime. Dišu plućima.j. a završava između 16. psilos = gol. Djelovanjem muških spolnih hormona (testosteron). Pojavile su se prije oko 390 milijuna godina (geološko doba devon). pneumatične kosti. započinje lučenjem GTH iz adenohipofize.dodatak 5. PTERIDOSPERME.

v. Tijekom metamorfoze razvijaju se pluća. životinje iz skupine člankonožaca. RAKOVI (Crustacea). purinske baze jednog lanca vežu se s komplementarnim bazama drugog lanca. čempresi. zrakasta simetrija. mokrice ili babure (pokretni 119 . Na kopnu uz more žive npr. količina energije koju tijelo dnevno utroši na radne aktivnosti. povisuje se osmotski tlak i voda ulazi u stanice zapornice. PULS (bilo). v.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tezom nastaje šećer. Najpoznatiji puževi na kopnu su: puž vinogradnjak i balavac. Puči se zatvaraju kad se turgor smanji u odnosu prema susjedicama. – 1869. dvodjelno vensko srce. npr. najbrojnija skupina mekušaca. bjeloočnica. kostur i drugi organi. v. koji se opiru bitnijoj promjeni pH. v. Ima škrge. fosfatni ili proteinski puferi. pulsiranje arterija koje se može mjeriti na mjestima koja su bliže površini tijela. Budući da srce ubacuje u aortu krv na mahove (oko 70 puta u minuti). RADNI METABOLIZAM. opisuje protoplazmu. Koriste se u istraživanju stanica npr. acido . RAHITIS. te se one raspadaju uz pojavu ionizirajućeg zračenja. a u kopnenim vodama: barnjak. PUFERI. priljepak. J. Vanjskim izgledom punoglavac je sličan mladoj ribici. PUŽEVI. stražnjoškržnjake i plućnjake.bazna ravnoteža. bikarbonatni. RNA). Puževi imaju spiralno zavijenu kućicu ili su bez nje (npr. Hrani se algama i postupno se preobražava u odrasli oblik. dječja bolest kostiju koja nastaje zbog slabe kalcifikacije kostiju. Prednjoškržnjaci su razdvojenog spola.). PURKINJE. Metamorfoza traje oko 3 mjeseca. Princip komplementarnosti vrijedi i pri sintezi RNA. krv u arterijama teće pulsirajućim tlakom. ogrc i puzlatka. U molekuli DNA. divergentna evolucija. organski spojevi iz skupine dušičnih baza koje se nalaze u sastavu nukleinskih kiselina (DNA. a stražnjoškržnjaci i plućnjaci su dvospolci. (1787. god. balavci). ploštenjak i ogrc. RADULA. Ako u hrani nemaju dovoljno kalcija i vitamina D3. u moru: volak. ličinka žabe. Otkrio razgranate neurone u mozgu nazvane Purkinjove stanice. isp. PUPULJICA. PUNOGLAVAC. kemijske tvari u krvnoj plazmi. isp. izotopi elemenata koji imaju nestabilne jezgre. v. Živi u vodi. neće se ni ispravno ni dovoljno stvarati anorganski dio kostiju što uzrokuje savitljivost i deformaciju. trenica. PURINSKE BAZE. RADIONUKLIDI (radioizotopi). neparnu repnu peraju. pomoću radioaktivnog izotopa ugljika dokazano je da se u procesu fotosinteze ugljik(IV)-oksid iz zraka ugrađuje u molekulu šećera. a nestaju škrge i rep. Purinske baze su adenin i gvanin. kosti. Ličinački razvoj žabe naziva se preobrazba ili metamorfoza. Asimetrične su životinje jer je tijekom evolucije nastalo zakretanje ili torzija tijela. PUPILARNI REFLEKS. RADIJALNA SIMETRIJA. S obzirom na stupanj torzije tijela dijele se na: prednješkržnjake. R RAČVASTA EVOLUCIJA. svitak i bočnu prugu. noge. v. češki citolog koji 1839.

Ostali su rakovi vodeni organizmi. početne reakcije fotosinteze koje započinju kada svjetlosna energija Sunca izbija elektrone iz molekule klorofila. "mozak". RAŽOVA GLJIVICA. Na zatku su noge za hodanje. isp. Druga osjetila su za ravnotežu (statociste). razvitak novih jedinki. saprofagi. uzastopni prijelazni oblici na kojima se mogu pratiti postupne promjene i razvoj neke vrste ili cijele skupine. RAZLAGAČI v. Svako okašce prima dio slike koja se slaže poput mozaika. Od viših rakova (imaju 20 kolutića) poznati su npr. slona i barskog puža ogrca. Iz njih se razvijaju ličinke koje se presvlače nekoliko puta tijekom svog poslijezametnog razvitka. a njegovi ostaci nađeni su u istočnoj Africi. omnivori. RAZVITAK ČOVJEKA. pupanje i vegetativno razmnožavanje (dijelovima tijela višestaničnih biljaka). REAKCIJE NA SVJETLU (reakcije ovisne o svjetlosnoj energiji). Spolnim razmnožavanjem se dobivaju potomci s novom kombinacijom gena. Glava i prsa najčešće su srasli u glavopršnjak. parazit na plodnici trava gdje se u klasu na mjestu pšena razvija roščić. proces koji započinje začećem. Za izlučivanje imaju ticalne ili antenalne žlijezde . Dim cigarete oštećuje stanice dušnika. Dišu škrgama koje su na nogama hodalicama. Potomci nastali nespolnim načinom razmnožavanja genetički su identični matičnoj stanici.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ oblici) i vitičari (sjedilački oblici). a može biti spolno ili nespolno. (bronhalni karcinom). a obuhvaća embrionalni. RAMAPITEKUS (Ramapithecus). mnogostruka (multipla) dioba. Važan su paleontološki dokaz evolucije. Elektroni putuju preko niza prenosilaca natrag prema klorofilu. RAZVOJNI (filogenetski) NIZOVI. Jedinke koje nespolnim načinom daju potomke stvaraju klon. a pri tom prijenosu dio energije predaju za 120 . a te oštećene stanice početni su stupanj razvoja tumora koji raste i širi se na pluća. Služi za dobivanje preparata koji se u porodiljstvu rabi za izazivanje grčenja uterusa te kao temelj halucinogene droge LSD. odnosno biljci. RAK PLUĆA. opip. Ti sklerociji sadrže otrovni alkaloid ergotin koji je ljekovit ako se ispravno primjeni. RAZNOJEDNI ORGANIZMI. Ženke nose oplođena jaja prilijepljena na nekom vanjskom organu. Na prsima imaju tri para čeljusnih nogu i pet pari za hodanje. v. kao vodenbuha i ciklop. u 99% slučajeva se susreće kod pušača. RAZRED. Indiji i Europi. Claviceps purpurea). Danas se smatra da je u toj skupini kroz vrlo dugo razdoblje došlo do najveće preobrazbe u smjeru nastanka čovjeka. Dobro su proučeni razvojni nizovi konja. Oplođuju se pomoću paketića spermija. izumrli oblik primata koji je živio već prije 15 milijuna godina. potomaka. riječni rak. jedan od najčešćih i najteže izlječivih oblika raka. Jednostavnije građeni rakovi su planktonski niži raci. Na glavi se nalaze dva para ticala i jedan par složenih očiju. fetalni i postnatalni (poslijeporodni) razvitak čovjeka do njegove zrele dobi. v. sklerocij. Presvlačenje je fiziološki proces koji kontroliraju hormoni iz neurosekretornih stanica živčanog sustava. Spolnim razmnožavanjem nastaju raznolikije jedinke nego nespolnim. Postoji više oblika nespolnog razmnožavanja: dvojna (binarna) dioba. miris. škamp i hlap. Pripadaju skupini deseteronožnih rakova. (ergot. jastog. Oči se sastoje od mnogo malih okašaca. zvanih omatidije. RAZMNOŽAVANJE. U glavi je glavni ganglij. filogenetski sustav.

reakcije fotosinteze koje se nadovezuju na reakcije na svjetlosti. npr. REAKCIJE OVISNE O SVJETLOSNOJ ENERGIJI. mejoza. kada organizmi nose iste alele za to svojstvo. zatvaraju ga živčane stanice sa svojim živčanim vlaknima. Recesivno svojstvo do- 121 . smeđa boja dlake goveda. RECESIVNO SVOJSTVO. reakcije na svjetlu. reakcije oduzimanja kisika. REAKCIJE NEOVISNE O SVJETLOSNOJ ENERGIJI. Vodik iz vode privremeno vezan u spoj NADPH2 poslužit će u reakcijama u tami za redukciju CO2. virnjaka. Voda se razlaže djelovanjem svjetlosne energije (fotoliza vode. Pojedini refleksi su prirođeni refleksi (npr. REFLEKSNI LUK. v. bezkralježnjaka: spužve. aa ili bb itd. tj. Kalvinov ciklus). međuneuron i motorički neuron). kašljanje. brza. položaj jedne molekule ili para molekula klorofila a u fotosistemu. To je monosinaptički refleksni luk (jedna sinapsa i dva neurona osjetilni i motorički). svrsishodna. NADPH prima i ione vodika koji nastaju razlaganjem vode te na taj način NADPH prelazi u reducirani oblik NADPH2. (potisnuto svojstvo). Kao produkt ovih reakcija oslobađa se kisik koji odlazi u atmosferu.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE sintezu molekula ATP-a. gutanje. Recesivna svojstva su. niski rast graška. npr. svojstvo koje ne dolazi u fenotipu uvijek do izražaja. To su. U primjerima križanja aleli za recesivno svojstvo označuju se malim slovima. RED. filogenetski sustav. Postoje i disinaptički refleksni luk (dvije sinapse i tri neurona osjetilni. REDUKCIJSKA DIOBA. v. mišića koji će izvršiti radnju. v. REFLEKS.). motorička reakcija na primljeni podražaj bez sudjelovanja kore velikog mozga i bez reakcije svijesti. ovčji metilj. NADPH2 kao izvor vodika i ATP kao izvor energije. Jednadžbu reakcija u tami možemo sumarno prikazati ovako: NADPH2 + CO2 + E (ATP) → C6H12O6 (glukoza) lazi u fenotipu do izražaja samo u slučaju homozigotnosti. a hidroksil ioni otpuštaju elektrone koji odlaze preko niza prenosilaca u klorofil nadomještajući mu elektrone koji su mu izbijeni da bi prešli na molekule NADP. sposobnost obnavljanja izgubljenih dijelova tijela. motoričkog neurona i izvršitelja (efektora) tj. gljive i bakterije. REAKCIJE U TAMI (reakcije neovisne o svjetlosnoj energiji. Sastoji se od osjetilnog (receptorskog) neurona. Posebnu skupinu čine uvjetovani refleksi. vodikovi ioni se vežu na NADP. v. kihanje i dr. koje sudjeluju u odvijanju refleksa. zvjezdače. reakcije spajanja s vodikom itd. v. kemijska reakcija u kojoj neka molekula. npr. sinapse u leđnoj moždini. Isp. Kod npr. To je skup vrlo složenih biokemijskih reakcija u kojima se ugljik(IV)-oksid postupno reducira vodikom do šećera glukoze uz utrošak energije. Među kralježnjacima to se svojstvo očituje u re- REAKCIJSKO SREDIŠTE. isp. Kao što je rečeno. sisanje.ione. hidre. reakcije u tami. razlagači organskih tvari. a drugi su stečeni na temelju iskustva. Refleks je usmjeren na zaštitu organizma. REDIJE. Dio elektrona koje svjetlosna energija izbija iz klorofila ne vraća se natrag nego prelazi na spoj NADPH. ionizacija vode) na H+ i OH. saprofagi. REDUCENTI. REGENERACIJA. krvna grupa 0 u čovjeka itd. REDUKCIJA. Za njihovo odvijanje neophodni su ugljikov dioksid. atom ili ion prima ili dobiva jedan ili više elektrona. Osim elektrona. ježinca ili mješčićnice.

Rekombinantna DNA . REGULATORI RASTA. Sposobnost regeneracije je manja u životinja na višem stupnju razvoja. enzim koji reže dvostruki lanac DNA na specifičnom mjestu na određene dijelove. Rh – FAKTOR. Rh-aglutinogen. RNK virusi čija se genetička uputa prevodi u DNK uz pomoć vlastitog enzima reverzne transkriptaze. a sudjeluje u razgradnji bjelančevine kazeina iz mlijeka. Prijelazni su oblik jer prve pokazuju razvoj prema kopnenim životinjama. rhesus faktor). koje se u nekih vrsta zadrže tijekom čitava života. ali se razmnožavaju u vodi. RESTRIKCIJSKI ENZIM (restrikcijska endonukleaza). životinjske i ljudske. RESPIRACIJA. Kostur njihove prsne peraje ima sličnosti s kosturom prednje noge vodozemaca. Dišno središte se dopunski podražuje povećanom razinom ugljikovog dioksida u krvi odnosno smanjenom razinom kisika u krvi. REKOMBINACIJE. disanje. hrvatska sibireja. REKOMBINANTNA DNA. čine živčane stanice smještene u produženoj moždini koje autonomno određuje frekvenciju disanja. v. a posljedica su nezavisnog odvajanja kromosoma i krosingovera. v. kojih nije bilo u roditelja. Neki su relikti ujedno i endemi. Neki se od repaša mogu razmnožavati u ličinačkom stanju. v. v. RENIN. u paleozoiku. stara skupina riba koštunjača iz perioda devon. Neke resoperke iz roda Latimeria žive i danas i nazivaju se živi fosili. Ta se pojava zove neotenija. REPAŠI. kao kod čovječje ribice. RESPIRATORNI SUSTAV. a genetički ih inženjeri upotrebljavaju za stvaranje rekombinantne DNA. skupina vodozemaca koji i kao odrasli oblici imaju rep. ali se kasnije smanjio zbog promjene klime. Najpoznatiji su repaši daždevnjaci i vodenjaci. pa čak pluća i gonade. Imaju dobro razvijene udove za kretanje. Rh-sustav. Neki kopneni daždevnjaci nemaju pluća. nogu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ patih vodozemaca. koji se može nalaziti na membranama eri- 122 . biljni hormoni. Daždevnjaci mogu obnoviti stopalo. dišni sustav. Ti se enzimi izoliraju iz bakterija. REVERZNA TRANSKRIPTAZA. a životinjski relikti su čovječja ribica. Biljni relikti u Hrvatskoj su velebitska degenija. isp. vučja stopa itd. oči. Odrasli repaši žive uglavnom na vlažnim mjestima. fenotip. sredozemna medvjedica itd. gamete stanica ili organizme koji su nastali prirodnom genetičkom rekombinacijom. RESPIRACIJSKO (dišno) SREDIŠTE. RESOPERKE. v. jedan od antigena. Ličinke su slične odraslima. pojava novih kombinacija gena koje se u fenotipu očituju kao nove osobine. rep. RETROVIRUSI. Imaju vanjske škrge. tzv. isp. isp. naziv koji se primjenjuje za: genotip. DNA proizvedena spajanjem gena od različitih vrsta. RELIKTI.tehnologija omogućava prijenos gena iz jedne vrste u genom druge vrste: biljne. Koža je bogata žlijezdama koje mogu izlučivati otrovne tvari. Rh SUSTAV (Rh-faktor. enzim kojega izlučuje želudac djeteta u vrijeme sisanja mlijeka. pa se plinovi izmjenjuju kroz kožu. podneblja ili drugih obilježja staništa. a punoglavac žabe rep i noge. biljne i životinjske vrste kojima je areal u prošlosti bio mnogo širi. REKOMBINANTNI TIP. retrovirusi.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE trocita. Ribe vide na malu udaljenost. a mužjaci ih prekrivaju spermom (mliječ). rRNA. Molekula RNA građena je samo od jednog poli- RIBOSOMI. trahoma itd. Rh(+). Na ribosomima koji se nalaze slobodni u citoplazmi sintetiziraju se proteini koji će ostati u stanici. Vidljiva su samo elektronskim mikroskopom. Do sinteze stečenih Rh-aglutinina dolazi u imunološkom sustavu samo imunizacijom Rh(–) osobe eritrocitima Rh(+) osobe i to samo u 2 slučaja: nakon pogrešne transfuzije krvi Rh(+) osobe u Rh(–) osobu i tijekom trudnoće Rh(–) majke koja nosi Rh(+) dijete. Tijelo je pokriveno ljuskama. dok se na ribosomima vezanim uz membrane endoplazmatske mrežice sintetiziraju proteini koji će se izlučiti izvan stanice. kod životinja i čovjeka uzročnici su teških oboljenja. trup i rep. Poznato je oko 20000 vrsta. podzemna stabljika. Strujanje vode osjećaju bočnom prugom. Svaki ribonukleotid sastoji se od triju vrsta molekula: fosfata. kuglastog ili štapićastog oblika. 6. RIBONUKLEINSKA RNA. Nosne šupljine su samo mirisne jamice. RIBOSOMSKA RNA. Građeni su od dviju vrsta 123 . zrnca u citoplazmi svih vrsta stanica. Nalaze se slobodni u citoplazmi ili su vezani uz membrane zrnate (hrapave) endoplazmatske mrežice. Ženke legu jaja (ikru). Ribe dišu škrgama. Ribe imaju samo unutarnje uho. RNA (ribonukleinska kiselina. v. u tzv. bakterije izuzetno malih dimenzija. U krvnoj plazmi Rh(+) i Rh(–) osoba nema prirođenih protutijela kao što su uobičajena kod osoba krvne skupine A. 7 ili 8 ribosoma. Imaju 2 para parnih peraja i 3 ili više neparnih. a strukturne: HO CH2 H H O H OH HO OH H Izgrađuje nukleotide ribonukleinske kiseline (RNA). KISELINA. psitakoze. a neke su i živorodne. pokrovno tkivo. šećera riboze i jedne od četiri dušične baze (adenina. RIZODERMA. Kao obligatni paraziti. Plivaći je mjehur ispunjen plinom i služi kao hidrostatski organ. B i 0. složeni organski spoj građen od većeg broja ribonukleotida. Za izlučivanje im služi drugi bubreg (mezonefros). Razmnožavaju se jajima. a one koje ga nemaju Rh-negativne. Osobe koje imaju taj antigen su Rh-pozitivne. grozdove od 5. Žive u moru i slatkim vodama. RIBOZA. rhiza = korijen). Rh(–). RHESUS FAKTOR. Na vretenastom tijelu razlikuje se glava. v. RIKECIJE. Krvotok je zatvoren. Prema građi tijela ribe dijelimo na: hrskavičnjače i koštunjače (zrakoperke i nosnoprolaznice). RNK). kožno staničje posve mladih dijelova korijena. citozina ili uracila). Osjetilni organi su prilagođeni životu u vodi. Rh-sustav. kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O5. v. RIZOMA (grč. Srce je dvodjelno i vensko. pjegavog tifusa. Na ribosomima se odvija sinteza proteina. molekula: proteina i RNA. v. Hladnokrvne su životinje. a naziv je dobio prema vrsti majmuna (Macacus rhesus) kod koje je prvi put otkriven. U koži su žlijezde koje izlučuju sluz. poliribosome (polisome). stabljika. prvi kralješnjaci u kojih su razvijene čeljusti i hrskavična ili koštana kralježnica. podanak. Ribosomi koji se u citoplazmi nalaze slobodni mogu biti povezani u skupine. Oplodnja je uglavnom vanjska. gvanina. RIBE (Pisces). Očni su kapci prozirni i srasli.

SAHARIDI. samosakaćenje. ROŽNICA (cornea). a najviše ih ima u citoplazmi stanice i na ribosomima. rRNA (rRNK. dunja. Stijenke su rodnice vrlo rastezljive. odstranjenje organskih tvari u smislu odvijanja kruženja tvari i protjecanja energije u ekosustavu. zakržljali organi koji u organizmu nemaju više nikakve funkcije ili je ona svedena na minimum. koštunjače (trešnja. Na molekule rRNA otpada 60 do 80 % ukupne stanične RNA. Molekule rRNA sintetiziraju se u jezgrici (nukleolusu). RUŽE. v. ribosomska RNA). SAHAROZA (tršćani šećer). RNK. Kloroplasti sadržavaju vrlo mnogo tog enzima. trtica. pročišćavanje otpadnih voda na osnovu bioloških zakonitosti tj. v. RUDIMENTARNI ORGANI. kruška. rudimenti. glog. malina. RODBINSKO SUSTAVOSLOVLJE. samosakaćenje. ugljikohidrati. disaharid. badem) i jabučnjače (jabuka. breskva. Povezuje vrat maternice s vanjskim spolovilom. šumska jagoda). cjevasta tvorevina duga 7 do 11 cm. ostaci kukovlja u kita i nekih zmija. enzim koji ubrzava razgradnju molekula RNA. RUBISKO (ribuloza-1. v. SAMOAMPUTACIJA. bjeloočnica. autotomija. Dobiva se iz šećerne trske i šećerne repe.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nukleotidnog lanca koji može biti ispružen ili savijen na različite načine. v. v. tip ribonukleinske kiseline koja zajedno s proteinima izgrađuje ribosome. v. Položaj i broj plodnih listova je promjenljiv. rudimentum = prvi početak. U biosferi ga ima više negoli bilo koje druge bjelančevine. ROD. Sastavljen je od dvije molekule jednostavnih šećera i to od jedne molekule glukoze i jedne molekule fruktoze. filogenetski sustav. RNA ima važnu ulogu u sintezi proteina. Vanjski otvor rodnice leži ispod vanjskog otvora mokraćne cijevi. npr. ribosomska RNA (rRNK ili rRNA) i transportna RNA (tRNK ili tRNA). v. samoosakaći- 124 . RNaza. zub mudrosti. Dokaz su evolucije. v. tjelesna dlakavost itd. SAMOOČIŠĆENJE (autopurifikacija) VODA. To su. Molekule RNA sintetiziraju se u jezgri na kalupu molekule DNA. filogenetska sistematika. interfaza. predstavnici ove skupine dvosupnica imaju pravilne. kupina. šljiva. SAMOSAKAĆENJE (autoamputacija. kod čovjeka su to crvuljak slijepog crijva. RUDIMENTI (rudimentarni organi. Dijele se na: ružičnjače (divlja ruža. oskoruša). dvospolne cvjetove s peteročlanim obojenim vjenčićem i mnogo prašnika. Razlikujemo tri tipa RNA: glasnička (messenger) RNA (gRNK ili mRNA). RODNICA (vagina). S S-FAZA. lat. RNA. pokušaj). U predvorju rodnice je djevičanski zalistak (hymen). samosakaćenje. SAMOOSAKAĆIVANJE.5-difosfat karboksilaza). kemijski spoj. v. ugljikohidrat iz skupine saharida. enzim koji katalizira prvu reakciju Calvinova ciklusa tijekom fotosinteze.

slanoći i količini hrane ili mriještenje. god. mošnja. Hrane se usitnjenim. Novi rep kod gušterice se brzo obnovi i naraste. prirodni odabir. Posebno važni saprofagi su heterotrofne bakterije koje razlažu organske tvari do anorganskih sastojaka: vode.). odnosno rast. v. SEKUNDARNA IMUNOLOŠKA REAKCIJA.). repa kod daždevnjaka ili guštera. brzina sedimentacije. ali umjesto kralješaka podupire ga hrskavica. v. nastije. barijere u vodotocima nastale vrlo složenim procesom koji završava taloženjem otopljenog vapnenca na mahovine sedrotvorce. “stanične teorije”. – 1882. Rep se odvaja na posebnome mjestu. organizmi koje ubrajamo u skupinu heterotrofa. oblik ponašanja riba. Zajedno s njemačkim zoologom Schwannom utemeljitelj je tzv. organizmi koji žive na uginulim organizmima. nastali CaCO3 talože na površini mahovina koje odumiru i na koje se slažu nove što uzrokuje “rast” barijera: Ca(HCO3)2 → H2O + CO2 + CaCO3 SEIZMONASTIJE. ovojnica mišićnog vlakna v. djelomično razgrađenim i uginulim biljnim dijelovima ili životinjskim izmetom ili životinjskim lešinama. SCHLEIDEN. poprečnoprugasti mišić. SEDRENE BARIJERE. proces proizvodnje organskih tvari heterotrofnih organizama. (1804. SEKUNDARNI RAST. a protoplazmu naziva fizičkim temeljem života. v. – 1881. SARKOLEMA. utvrdio da su stanice osnovni građevni elementi svih životinja. gljive). utvrdio da su stanice osnovne strukturne jedinice svih biljaka. SEKUNDARNA ORGANSKA PROIZVODNJA (sekundarna bioproizvodnja). Uzroci putovanja riba na druga mjesta su sezonske promjene u temperaturi. SCHULTZ. v. “staničnu teoriju”. imuna memorija. otkinuće u slučaju opasnosti npr. SELIDBA (migracija) RIBA. Zbog te svoje uloge heterotrofne bakterije nazivamo i razlagači (reducenti). uz vodu. v. SCHWANN. 125 . 60 . 19. SEDRA. M. a. v. SAPROFAGI. prirodni odabir. SCROTUM. SEDIMENTACIJA. T. Te tvari mogu iskoristiti zelene biljke u procesu fotosinteze. god. njemački botaničar koji je 1838. sedrene barijere. S vodom najprije reagira ugljikov dioksid nastao disanjem organizama u vodi pri čemu nastaje ugljična kiselina: CO2 + H2O → H2CO3 Ugljična kiselina otapa vapnenac dajući topljivi kalcijev hidrogenkarbonat: H2CO3 + CaCO3 → Ca(HCO3)2 Cijanobakterije iz bikarbonata otopljenih u vodi uzimaju CO2. v. Najznačajniji heterotrofi koji ostvaruju sekundarnu organsku produkciju su životinje. povećanje mase i volumena tijela te razmnožavanje heterotrofnih organizama.ih god. stoljeća opisuje stanicu kao nakupinu protoplazme s jezgrom. hraneći se organskim tvarima u raspadanju (npr. Zajedno s njemačkim botaničarem Schleidenom utemeljio tzv. J. (1810. SAPROFITI. njemački zoolog koji je 1839. ugljikovog dioksida i mineralnih tvari.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vanje). SELEKCIJA. M. SELEKCIJSKI PRITISAK. povećanje promjera stabljike i korijena mnogih biljaka (posebice drvenastih trajnica) kao rezultat diobe stanica bočnih meristema.

kineski pračovjek. a odvija se u jezgri gdje se genska uputa prepisuje s DNA na glasničku RNK (mRNA). mjesto prijenosa živčanog podražaja (impulsa) s aksona na drugu živčanu stanicu. DNA koja se nalazi u jezgri (genska DNA) u redoslijedu svojih nukleotida. Djelovanje simpatikusa je suprotno djelovanju parasimpatikusa. SIMBIOGENEZA. Svaki triplet prepisan s DNA na mRNA zove se kodon i 126 . SESILNI ORGANIZMI. Prema djelovanju sinapsi na neuron. isp. živčano . mikoplazmodija (citoplazma). SIMPATIKUS. Početna etapa u procesu sinteze proteina je transkripcija ili prepisivanje. pravirusa (jezgra) i zavojite bakterije tipa današnje spirohete (bič). odnos između dviju ili više jedinki različitih vrsta iz kojega te jedinke imaju korist. S. SINDROM. razlikujemo pobuđivačke (eksitacijske) i potiskivačke (inhibicijske) sinapse. dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa povećavajući ili smanjujući aktivnost tih organa. SEROZA. sjedilački. neurohormoni. SINTEZA PROTEINA (sinteza bjelančevina). god. Ovim procesom upravlja molekula DNA uz posredovanje nekoliko vrsta RNA (mRNA. znanstvenici koji su 1972. SIFILIS (lues). SINAPSA (grč. spolna zarazna bolest čiji je uzročnik bakterija spiroheta. Jedinice takve upute čine grupe od po tri dušične baze. a neliječeni sifilis uzrokuje teška oštećenja gotovo svih organa i na kraju smrt. Primjer simbiogeneze jednostaničnih alga i gljiva je lišaj. v. žljezdanu stanicu ili mišić. v. SIDA. SIMBIOZA (potpomaganje). rRNA). ali su reproduktivno izolirane zbog različitog ponašanja ili različitog sazrijevanja gonada. a druga nema niti koristi niti štete. isp. SINTEZA BJELANČEVINA. trojke ili tripleti. nazivamo komenzalizam. Pri prepisivanju se sintetizira lanac mRNA po principu komplementarnosti.mišićna veza. Smatra se da je prva biljna stanica nastala simbiogenezom: modrozelene alge (plastid). tRNA. rak samac živi u simbiozi s moruzgvom (tzv. neke alge i gljive žive u simbiozi u obliku lišaja. Preko sinapse se prenosi impuls samo u jednom smjeru. razradili i danas prihvatljiv model membrane koji se zove “model tekućeg mozaika”. SINANTROPUS. bršljan ili slak. synapsis = sveza). udruživanje pojedinih prokariotskih organizama. slabo pokretni organizmi. mutualizam) itd.J. sinteza proteina. zrakasta simetrija i bentos. kao npr. U ranim stadijima bolest je izlječiva. skupina različitih znakova (simptoma) bolesti koji se javljaju zajedno. npr. i NICOLSON. SINGER.. SIMPATRIJSKA SPECIJACIJA. v. specijacija kada se populacije nalaze na istom prostoru. Isp. Svaka trojka je šifra za jednu određenu aminokiselinu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SERIN. kemijski spoj iz skupine aminokiselina. Odnos u kojem jedna vrsta ima koristi. protobakterije (mitohondrij). AIDS. isp. Kroz sinaptičku pukotinu impuls prenose kemijski prijenosnici (neurotransmiteri) tj. odnosno dušičnih baza sadrži uputu za sintezu nekog proteina. v.L. kod amniota treća zaštitna zametna ovojnica. specijacija. tzv. proces koji se odvija na ribosomima u citoplazmi stanice u kojem se iz aminokiselina sintetiziraju proteini. G.

dojka). 127 . Čeljusti i zubi im omogućavaju da žvaču hranu. UGA i UAG. Toplokrvni su organizmi. U procesu translacije veliko značenje imaju molekule transportne ili prijenosne RNK (tRNA) koje na sebe vežu po jednu aminokiselinu i donose je na ribosom. tobolčare i prave sisavce (plodvaši ili placentalni sisavci). SISTEMATSKE JEDINICE. taksonomija). pa se venska i arterijska krv ne miješaju. antikodon preko kojega se veže na odgovarajući kodon na mRNA. SISAVCI (Mammalia. treći bubreg. tj. Sisavci su se razvili od skupina mezozojskih prasisavaca. One služe za provođenje asimilata (produkata fotosinteze). Udovi su ispod tijela i mogu se okretati. tzv.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE odgovara pojedinoj vrsti aminokiseline. lat. veliki optok krvi. isp. odnosno razvrstavanje živih bića u filogenetski prirodni sustav. Srce je podijeljeno na lijevu i desnu stranu. mamma = sisa. Za izlučivanje mokraće. Time započinje druga etapa sinteze proteina koja se zove translacija ili prevođenje zato jer se kodoni na mRNA prevode u točno određene aminokiseline. filogenetski sustav. systole = stezanje). tlak krvi na stijenke arterija u trenutku kada stezanjem (sistolom) srčanog mišića uđe u aortu nov (udarni) volumen krvi. Prednji dio mozga ili veliki mozak dobro je razvijen i na površini ima sivu koru. SISTOLA (grč. Preci pravih sisavaca bili su prakukcojedi. Raznolikom funkcionalnom građom svih organskih sustava prilagodili su se najrazličitijim načinima života i preživljavanju u svim mogućim staništima. na kodon UAU vezati tRNA s antikodonom AUA i donijeti aminokiselinu triptofan. Prema raznolikosti tjelesne građe dijele se na: jednootvore (kljunaše). Resice u tankom crijevu povećavaju probavnu površinu. SITASTE CIJEVI. rijetko dvonožnom. Površina pluća se povećala velikim brojem plućnih alveola. v. Kisik se veže za dišni (krvni) pigment hemoglobin. Tijelo sisavaca je pokriveno dlakom koja ih štiti od gubitka topline. kretanju. Da bi održali stalnu tjelesnu temperaturu moraju imati brz metabolizam tj. v. Tako će se npr. Nakon rođenja mladi sišu majčino mlijeko. kao i mliječne žlijezde koje su zapravo promijenjene kožne žlijezde. Zameci se razvijaju u maternici obavijeni posteljicom (placentom). Sinteza određenog proteina završava kada mRNA donosi kodon koji ne odgovara niti jednoj vrsti aminokiseline. provodni elementi u većine biljaka. od čega 109 vrsta u našoj zemlji. linjanje i zimski san). mRNA s preuzetom uputom odlazi iz jezgre u citoplazmu i veže se za ribosom. sisavci imaju pravi bubreg. zadnja (i najrazvijenija) skupina kralježnjaka koji su se razvili u životinjskom svijetu biosfere. Postoje tri takva kodona: UAA. SISTEMSKI OPTOK KRVI. Tako sisavci imaju prilagodbe na toplinu i hladnoću (v. Danas u biosferi živi oko 4500 vrsta sisavaca. znanost koja se bavi svrstavanjem živih bića u određene sustave koji se temelje na srodstvenim odnosima. Taj tlak se prenosi kroz velike i male arterije do arteriola i kapilara. moraju mnogo jesti i potrebna je velika izmjena O2 i CO2. kontrakcija ili stezanje srčanog mišića (klijetke ili pretklijetke). Kostur i mišići prilagođeni su četveronožnom. SISTEMATIKA (sustavoslovlje. To je svojstveno samo sisavcima. Svaka tRNA ima posebnu trojku baza. Molekule aminokiselina vežu se u molekulu proteina tako da se mRNA pomiče na površini ribosoma i prima redom molekule tRNA koje donose sa sobom aminokiseline. SISTOLIČKI TLAK.

U njemu se nalazi makrospora (megaspora. Slonovi pripadaju skupini polukopitara. a hranu skupljaju pomoću dugačke mišićave surle ili rila. dio muškog spolnog sustava. U sjemenim kanalićima odvija se spermatogeneza. Kljove su izmijenjeni sjekutići.pulpa.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SJEDILAČKI ORGANIZMI. intersticijske stanice izlučuju muške spolne hormone. nalazi na jednom polu. organ svojstven sjemenjačama. Sporangiji se razvijaju u obliku plodišta. Prema smještaju sjemenih zametaka sjemenjače se dijele u dvije velike skupine: golosjemenjače i kritosjemenjače. SLUZNJAČE. v. ameboidno. a sastoji se od sjemene lupine. SKLEROCIJ. biljni organ koji služi rasprostranjenju nove generacije biljaka. tzv. klice (embria) i hranjivog staničja (endosperma). Slezena nije uključena u limfni optok. U sredini svakog čvorića nalazi se središnja arterija kroz koju odlaze u optok krvi nastali limfociti. SJEMENICI (testisi). SKLERENHIM. korjenonošci. odvodni kanal koji provodi muške spolne stanice. Očnjaka nemaju. tučak. Sjemenka se razvija iz sjemenog zametka. isp. najopsežnija skupina kopnenih biljaka. Prehranom su većinom saprofiti. Surla je preobražen nos i gornja usna. SLUZAVCI. temperatura. Razlikujemo crvenu i bijelu pulpu. Crvena pulpa je mješano krvotvorno tkivo gdje se stvaraju eritrociti. U slezenu se pružaju vezivni tračci između kojih se smjestilo specifično tkivo slezene . Hrane se biljkama. v. bentos. kreću se plaženjem. Bijela pulpa su nakupine manjih limfnih čvorića (folikula) u samoj slezeni. SJEMENI ZAMETAK. v. ali ima ih i koje se se hrane poput životinja – uzimaju i probavljaju komadiće čvrste hrane. Od sjemenog zametka razvija se sjemenka. SJEMENKA. spermije od spolnih žlijezda do mokraćne cijevi. nego samo u krvni. embrionska vreća. monociti i plazma stanice. Jajna se stanica. U vegetativnoj fazi više se osobinama podudaraju sa životinjama (praživotinjama) – nemaju staničnu stijenku time ni stalan oblik. Specijalizirane stanice sjemenika. ražova gljivica. mošnjama. granulociti. zrak) sjemenka će proklijati i razvit će se mlada biljka. nikada od hitina. muške spolne žlijezde koje su u čovjeka smještene u kožnim vrećicama. Sve biljke koje stvaraju sjemenke nazivamo sjemenjače. U golosjemenjača leži otvoreno na plodnim listovima. SLEZENA. v. U sredini su dvije središnje stanice embrionske vreće. krvotvorni organ smješten ispod lijevog svoda ošita. najveći kopneni sisavci. Tu se zbiva i oplod- nja. a na drugom su tri stanice: antipode. U povoljnim uvjetima (vlaga. Homologan je makrosporangiju (megasporangiju. ženski gametofit) nastala tijekom makrosporogeneze i sastoji se od osam stanica. Imaju sjemeni zametak unutar kojeg se razvija ženski gametofit (embrionska vreća). različite od ostalih vrsta gljiva. Iznutra su ispunjeni stanicama i sjemenim kanalićima. najprimitivnije gljive. 128 . Njihove su spore s bičevima (zoospore) i čvrstom stijenkom od proteinskih tvari ili celuloze. ženskom sporangiju). SLONOVI. Na nogama imaju tri (afrički slon) ili četiri prsta (azijski slon) koji završavaju kopitastim noktom. SJEMENOVOD (ductus deferens). U vrijeme razmnožavanja pokazuju sličnosti s biljkama. SJEMENJAČE. s dvije pomoćnice (sinergide). potporno staničje. U čovjeka su sjemenovodi parni organi. U obliku sjemenke biljka se nalazi u pritajnom (latentnom) stanju. a u kritosjemenjača je "sakriven" u plodnici tučka.

SPECIJALIZIRANE FUNKCIJE STANICA. mitohondrija. osim uobičajenih staničnih struktura (jezgre. klorofil u biljnim stanicama omogućuje fotosintezu itd. SMEĐE ALGE. v. membrana. isp. v. ali nikada škrob. v. SORTA. isto što i antitijela. SPECIJALNA ADAPTACIJA (prilagodba). SOMATSKE VARIJACIJE. B i C. SOMATSKE MUTACIJE. tjelešce u lišaja koje sadrži jednu kuglastu stanicu alge obavijenu kratkom hifom odgovarajuće gljive. žljezdano staničje. SOREDIJ. SPECIJACIJA. izolacija. posebno smeđi fukoksantin. Poznate su alopatrijska. uz klorofil a i b. jestive. zakržljale oči kod životinja koje žive u tami. tjelesni živčani sustav. sjemena tekućina koju izlučuju muški spolni organi.) sadrže i specifične strukture koje određuju njihovu funkciju. Većinom se pojavljuje u muškaraca. Na primjer. SOMATOGAMIJA. Npr. SLJEPULJE. simpatrijska i parapatrijska specijacija. svojta. stapanje vršaka ženskih (+) i muških (–) primarnih hifa u sekundarnu hifu kod razmnožavanja stapčarki. SOMATSKA STANICA. Neke sadrže sluzavu tvar algin (alginske kiseline) koja se primjenjuje u tekstilnoj. SOL-stanje. Kloroplasti im. papirnoj. višestanični organizmi koji pretežito žive u moru. 129 . SOMATSKI ŽIVČANI SUSTAV. mutacije. v. gljive mješinarke s razvijenim plodištem. određene funkcije koje obavljaju stanice višestaničnih organizama koje su srodne po svojoj građi te formiranju tkiva. Takve stanice. SOMATOTROPNI HORMON. hormon rasta. kružnouste. SPERMA. nakupina sporangija s donje strane lista paprati. Specijacija se brže odvija u dobro odijeljenim područjima. ribosoma. U svakom mililitru ima oko 120 milijuna spermija. SPECIFIČNA PROTUTIJELA. sadrže i druge boje. v. prehrambenoj i drugim industrijama. Neke se smeđe alge koriste kao hrana i začini naročito zato jer obiluju vitaminima A. nesposobnost raspoznavanja boja koja se nasljeđuje kao spolno vezano svojstvo. te tako prehranjuju spermije. lizosoma i sl.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE SLJEPOĆA NA BOJE (daltonizam). ukupno oko 360 milijuna. v. SOJ. SMOLENICE. v. SMRČCI (Morchella). Produkti sinteze su različiti. spolno i nespolno. evolucijski proces nastajanja novih vrsta. mišićne niti u mišićnoj stanici omogućuju kontrakcije. skup osobina koje se razvijaju u određenim uvjetima. a u žena samo ako se gen za sljepoću boja (gen cb) nalazi u oba x kromosoma. tjelesna stanica. Geni koji su odgovorni za to svojstvo nalaze se u x spolnom kromosomu. Prosječno se u tijeku spolnog akta muškarca izluči oko 3 mL sperme. Razmnožavaju se vegetativno. Predstavnik je jadranski bračić (Fucus virsoides). v. SORUS. modifikacije. jedinstvena vrsta biljaka i nižih organizama. pojedine aminokiseline i enzime. tekući oblik koloidnih otopina. Sekreti sadržavaju fruktozu. Sastoji se od spermija i sekreta prostate i drugih žlijezda.

a neke. proces nastajanja muških spolnih stanica. cjevasto tijelo dobro opskrbljeno krvnim žilama i živcima. U sjemenicima iz zrelih zametnih stanica. v. spermatogonija mitotičkim diobama nastaju velike stanice. SPOJEVI. Sklone su konjugaciji. svojstva vezana za spolne kromosome. Sintezu i lučenje spolnih hormona stimuliraju gonadotropni hormoni. hormoni koji utječu na razvoj spolnih obilježja. Najbitniji dijelovi za funkciju penisa su tri spužvasta tijela. Repni dio je vrlo dug i omogućuje aktivno kretanje spermija. građena od brojnih šupljina. SPOLNO VEZANA SVOJSTVA. nezrele zametne stanice u sjemeniku iz kojih tijekom spermatogeneze nastaju spermiji. a na njenom vršnom dijelu nalazi se vršno tjelešce. Po svom kemijskom sastavu spolni hormoni su steroidi. Spermiji čovjeka su vrlo male stanice čiji su glavni dijelovi glava i rep. SPOLNO RAZMNOŽAVANJE. Iz svake spermatocite II u mejozi II (drugoj mejotičkoj diobi) nastaju po dvije spermatide iz kojih će postupnim izduživanjem nastati zreli spermiji. akrosom koji sadrži enzime koji omogućuju prodor spermija u jajašce. nitasta zelena alga. gameta što dovodi do rekombinacije gena. SPIKULE. izmjeni genetičkog materijala do kojeg dolazi kada se po dvije stanice susjednih niti spoje kanalićem. Prednji dio repa sadrži brojne mitohondrije u kojima se oslobađa energija potrebna za pokretanje spermija. koje kada se napune krvlju iz arterija služe za ukrućenje (erekciju) što omogućavae unošenje sjemena u rodnicu. U mnogih životinja i u čovjeka nastaju dvije vrste spermija: jedna vrsta nosi x spolni kromosom. SPERMIJI. SPERMATOGENEZA. Uglavnom ih izlučuju spolne žlijezde (sjemenici. Glava sadrži jezgru s 23 kromosoma. iz svake primarne spermatocite. muške spolne stanice.). v. citoplazmatskim mostićem pre- ko kojeg se potpuno pretoči sadržaj stanice jedne u stanicu druge niti. SPOLNI HORMONI. spužve. tzv. SPERMATOGONIJE. v. izlučuje kora nadbubrežne žlijezde. procesom spermatogeneze. v. haploidna generacija. primarne spermatocite (spermatocite I). SPOLNO SAZRIJEVANJE. spermija. a druga vrsta y spolni kromosom. SPOLNA ODREĐENOST POTOMAKA. Kroz ud prolazi mokraćna cijev koja izvodi mokraću i spermu. npr. čiste kemijske tvari izgrađene od dva ili više različitih. SPOLNA GENERACIJA. Znači. v. One sadrže diploidan broj kromosoma i iz njih će nakon mejoze I (prve mejotičke diobe) nastati sekundarne spermatocite (spermatocite II) s haploidnim brojem kromosoma. SPERMATOCITE. SPOLNI UD (penis). a spajanjem jajne stanice sa spermijem koji nosi y spolni kromosom nastaje potomak muškog spola. međusobno spojenih kemijskih elemenata. stanice koje nastaju u procesu spermatogeneze (isp. u 130 . u sjemenim kanalićima muških spolnih žlijezda. SPIRILI. spužvasto. ovisi o tome koji spolni kromosom donosi spermij pri oplodnji. pubertet. spermatogeneza. jajnici). sjemenika. androgene. stapanje spolnih rasplodnih stanica. nastaju četiri zrela spermija. bakterije. mišićno. Spajanjem jajne stanice sa spermijem koji nosi x spolni kromosom nastaje potomak ženskog spola. tzv.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SPERMATIDE. gamete koje nastaju u sjemenicima tijekom spermatogeneze. SPIROGIRA (Spirogyra).

Isp. nasljedna nesposobnost grušanja krvi (hemofilija). v.) SPONGIN. isp. šupljina u tijelu spužve. SPOLNO VEZANO NASLJEĐIVANJE. SPORE. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene oboljele od hemofilije sva će djeca oboljeti od hemofilije. haploidna generacija. SPOSOBNOST SAMOUMNOŽAVANJA. U spongocel voda s hranom (npr. (v. Žive u morima. DNA i RNA. Ostalih 50 % muške i 50 % ženske djece je zdravo. shemu u Dodatku 1. 4.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE čovjeka. gametofit. (V. SPOROFIT. SPUŽVE (Spongia). bakterijama. nespolna generacija u biljaka u kojoj nastaju nespolne rasplodne stanice. Iz odnosa muškarca oboljelog od hemofilije i zdrave žene rađaju se zdrava muška djeca dok su ženska djeca prenositelji. SPONTANE MUTACIJE. Spužve su 2. a ona se zbog svoje recesivnosti ispoljavaju kod muških potomaka. hemofilija itd. Stijenka tijela sastoji se od tri sloja stanica. v. 131 .) Iz odnosa zdravog muškarca i žene oboljele od hemofilije sva ženska djeca bit će prenositelji. a sva muška 5. Tako je kod papratnjača i sjemenjača sama biljka sporofit dok je gametofit veoma reduciran. spore. Evolucijom biljnog svijeta jače se razvija sporofit u odnosu na spolnu generaciju. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene prenositelja dobiva se potomstvo u kojem će 50 % muške djece oboljeti od hemofilije. Iz spora se u povoljnim uvjetima razvijaju nove biljke. spore. (V. (V. Nastaju u posebnim organima – sporangijima.) Iz odnosa zdravog muškarca i žene prenositelja dobiva se potomstvo u kojem je 50 % muške djece oboljelo od hemofilije. spužve. mutacije. (V. spužve. djeca će oboljeti od hemofilije. v. shemu u Dodatku 1. Nemaju izgrađena tkiva. v. nemogućnost raspoznavanja boja (daltonizam) itd. algama i sitnim životinjama) i kisikom ulazi kroz mnogobrojne sitne otvore na površini tijela. Geni koji određuju ta svojstva smješteni su u x spolnom kromosomu i zovemo ih spolno vezani geni. nasljeđivanje pojedinih svojstava čiji su geni smješteni u x spolnom kromosomu. dok su žene većinom samo prenositelji gena za ta svojstva. shemu u Dodatku 1. nespolne rasplodne stanice biljaka. a 50 % bit će prenositelji. gen za recesivno svojstvo daltonizam može se označavati malim slovom (a ili d) ili x. Neprobavljeni ostaci izlaze kroz najveći otvor ili oskulum. a samo mali broj vrsta u kopnenim vodama sjedilačkim načinom života. Pravila spolno vezanog nasljeđivanja mogu se izvesti iz slijedećih primjera: 1. U unutarnjosti je šupljina spongocel obložena bičastim stanicama ili hoanocitama. SPONGOCEL. a slično se označuje i gen za hemofiliju (h) ili x. a 50 % bit će zdravo. U čovjeka su takva svojstva daltonizam. Skelet izgrađuju vapnene ili kremene iglice (spikule) ili pak elastične bjelančevinaste niti spongina. dok će 50 % ženske djece oboljeti od hemofilije. a 50 % ženske su prenositelji. 3. U primjerima praćenja spolno vezanog nasljeđivanja. SPORANGIJ. najprimitivnije mnogostanične životinje.

Čovjek se zarazi zaraženom hranom ili vodom. Postoje i generativni organi koji isključivo služe razmnožavanju. Po dužini podijeljeno je na lijevo (arterijsko) i desno (vensko) srce.A) čvor (nalazi se u desnoj pretklijetki i predvodnik je rada srca) te sekundarno središte automacije srca ili atrio – ventrikularni (A .) počinje se hraniti eritrocitima iz sluznice crijeva te uzrokuje patogene promjene. isp. produžena moždina (medulla oblongata) i leđna moždina (medulla spinalis). To su: primarno središte automacije srca . Služi za izjednačivanje tlaka zraka u srednjem uhu s vanjskim tlakom. kopnene biljke). Spužve imaju sposobnost regeneracije. stremen (stapes). pušenjem itd. Stabljika i list nazivaju se jednim imenom izdanak. Dok se hrani crijevnim bakterijama. stabljiku i list. Nespolni pup se naziva gemula. SREDIŠNJI (centralni) ŽIVČANI SUSTAV. STABLAŠICE (više biljke. žile koje služe za provođenje minerala. ameboidnih stanica i hoanocita. Danas je poznato oko 5000 vrsta. Oplođuju se unutar tijela spužve iz kojeg izlazi trepetljikava ličinka parenhimula koja se pričvrščuje za dno i izraste u spužvu. praživotinja iz skupine korjenonošci.V) čvor (nalazi se na granici između pretklijetki i klijetki). Svaki taj dio podijeljen je poprečno. Smješteno je u sredini prsne šupljine između dva plućna krila u osrčju ili perikardu. u srcu se nalaze središta koja upravljaju radom srca. premoštena sa tri slušne košćice: čekić (malleus). SREDIŠTE AUTOMACIJE RADA SRCA. vegetativna organa. nasljedna je bolest uzrokovana sintezom nenormalnog hemoglobina HbS. obrađuje i pohranjuje primljene in- formacije te upravlja brojnim tjelesnim voljnim i autonomnim radnjama. Bolest je neizlječiva. SRCE. Vraćanje krvi iz aorte ili plućne arterije u srce nakon sistole sprječavaju semilunarni (polumjesečasti) zalisci. u njemu se odigrava fotosinteza. SRČANI MIŠIĆ. pa srce ima dvije pretklijetke (atriji) i dvije klijetke (ventrikuli). poprečnoprugasti mišić. SRDOBOLJNA AMEBA. Čine ga: veliki mozak (cerebrum). Razlikujemo tri temeljna. Kada se poremeti rad debelog crijeva (drugim zarazama. Između srca i stijenki perikarda nalazi se tekućina. Zoolozi smatraju da su se spužve razvile iz zadružnih bičaša.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ većinom dvospolci (hermafroditi). uzimanjem droge. Eritrociti su u obliku srpa i imaju smanjenu sposobnost prijenosa kisika. mala šupljina između bubnjića i unutarnjeg uha. mali mozak (cerebellum). nametnik u debelom crijevu čovjeka. hipoteze o postanku metazoa. Spolne stanice spermiji i jaja nastaju od tzv. Razmnožavaju se nespolno pupanjem i spolno. nije opasna. alkohola. postoji kožno staničje prekriveno voštanom pre- 132 . nakovanj (incus). Srednje uho je povezano s gornjim dijelom ždrijela Eustahijevom cijevi. v. SREDNJE UHO. SRPASTA ANEMIJA (anemija srpastih stanica). Korijen služi za učvršćivanje biljke i upijanje vode i otopljenih minerala. tri dijela njihovih tijela: korijen. šuplji mišićni organ koji kod čovjeka teži oko 300 g. Osrčje štiti od neposrednog pritiska na srce ili od trenja plućnih krila pri disanju. U biljaka postoje i provodni organi.atrijski ili sinus-atrijski (S . a između desne pretklijetke i klijetke trikuspidalni zalisci. biljna skupina prilagođena životu na kopnu. hranjivih tvari i kao potporno tkivo jer imaju lignizirane stanične stijenke. Između lijeve pretklijetke i klijetke nalaze se mitralni ili bikuspidalni zalisci.

trnovi. kloroplaste i druge plastide što ne nalazimo u životinjskih stanica. Osnovne razlike između biljnih i životinjskih stanica Biljne stanice Obavijene su celuloznom stijenkom. jedan od tri temeljna organa kopnenih biljaka. Preobrazbe stabljike: podzemne stabljike su podanak ili rizoma (npr. STANICE ZAPORNICE. lukovica (u sunovrata) i gomolj (krumpir). u perunike i paprati). Tako. STABLJIKA. Moraju dobiti hranu izvana pa su heterotrofne. STAFILOKOKI. odnosno životinjsku stanicu. Bez kloroplasta (klorofila) su. temeljna građevna i funkcionalna jedinica svakog živog bića (organizma). STANICA. a mogu se podijeliti na tri velike skupine. Na vrhu stabljike i bočnih ogranaka nalazi se vršni pup s tvornim staničjem za produžni rast. oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara veliki broj aktivira- 133 . mitohondriji i mikrotubuli. papratnjače i sjemenjače. STANIČNA IMUNOST. lizosomi. Kada su i prisutne. Stabljika može biti zeljasta ili drvenasta. Drvo ili stablo je oblik višegodišnje drvenaste stabljike s nerazgranatim dijelom deblom i razgranatim. stapke. puči za izmjenu plinova. krošnjom. Male stanice nepravilna oblika. Najjednostavniji jednostnanični organizmi su prokarioti čije stanice ne sadrže oblikovanu jezgru ni druge stanične strukture obavijene membranama. bilo biljne ili životinjske. U citoplazmi tipične eukariotske stanice nalaze se različite stanične strukture: endoplaz- matska mrežica. možemo podijeliti na prokariote i eukariote. nosi listove i druge organe koji su se razvili bilo preobrazbom stabljike bilo preobrazbom listova. Tipične eukariotske stanice sadrže jezgru obavijenu ovojnicom koja ima mnogobrojne pore kroz koje se izmjenjuju tvari između jezgre i citoplazme. Ostale jednostanične organizme i višestanične organizme. cvjetove i plodove. Stablašice su se razvile iz pradavnih zelenih alga. specijalizirane epidermske stanice lista koje okružuju otvor puči. bakterije. Velike stanice određenog oblika. Obavljaju fotosintezu pa su time autotrofne. Većina životinjskih stanica sadrži centriole koji se još nalaze samo u stanicama nekih algi. isp. Imaju velike vakuole ispunjene staničnim sokom. vitice. npr. vakuole su male. s obzirom na složenost građe njihovih stanica. Sva živa bića. Sadrže kloroplaste (klorofil). a razvija se iz klicinog pupoljka. v. filokadije itd. Zelena biljna stanica je autotrofna za razliku od heterotrofne životinjske stanice. izgrađuju eukariotske stanice. Životinjske stanice Nemaju celulozne stijenke. Osim tih struktura koje se nalaze gotovo u svim eukariotskim biljnim i životinjskim stanicama postoje i strukture karakteristične samo za biljnu. postoje otvori. biljne stanice sadrže staničnu stijenku. Ona je os izdanka. tri odjeljka: mahovine. Golgijevo tijelo. sprermišni organi (u korabice).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vlakom (kutikulom) koja štiti biljku od isušivanja.

M. STANIČNA TEORIJA. bios = život. STAPČARKE. Kemijske reakcije u stanici možemo podijeliti u dvije skupine: procesi izgradnje (anabolizam) i procesi razgradnje (katabolizam). plastidi. STANIČNO FRAKCIONIRANJE. W. rezanjem vrtećim noževima ili ultrazvučnim vibracijama. Ljudska stanična tekućina 4 ima pH 7. Postoje i manje strukture unutar stanice koje također vrše važne funkcije npr.) američki znanstvenik koji je prvi izdvojio virus u čistom stanju.) u kojem živi populacija jedne vrste. v. prostor sa svim životnim uvjetima (svjetlo. rastavljanje stanica na sastavne dijelove. Glavni sastojci stanične tekućine su voda. Stanični ciklus započinje od trenutka kada ta stanica nastaje diobom i traje sve dok se i ona sama ne podijeli na dvije nove stanice. Plo- 134 . a za neke je nepropusna. ali kako nisu obavijeni membranom ne smatramo ih organelima u užem smislu. Schleiden i zoolog T. STANIŠTE (biotop. jezgra. v. ugljik(IV)-oksid. STANIČNI ORGANELI. grč. kalijev kation (K+) te − hidrogen karbonatni ( HCO 3 ) i sulfatni ( SO 2− ) anion. Stanična membrana je selektivno propusna što znači da ne propušta sve tvari jednako. ribosomi. jezgrice. Najprije se stanice kidaju gnječenjem tkiva u tarioniku. STANIČNO DISANJE. STANIČNA TEKUĆINA je tekućina unutar stanice. STANIČNA STIJENKA. već vrši selekciju: neke tvari propušta lako. Schwann. (1904. Zatim se tako dobivena stanična kaša centrifugira.. Golgijevo tijelo. neke teže. U ljudskom tijelu je ima oko 25 litara.-1971. STANIČNI METABOLIZAM. voda. mineralne tvari itd. To je bio virus mozaične bolesti duhana. životni ciklus stanice koji se sastoji od dva razdoblja interfaze (razdoblje između dvije stanične diobe) i mitoze (diobe stanice). Stanični organeli su jezgra. skup svih kemijskih reakcija u stanici odnosno izmjena tvari i energije u stanici. botaničar M. Stanična tvorevina koja obavija većinu biljnih stanica i daje im oblik i čvrstoću. Centrifugiranjem se pojedini stanični dijelovi razdvajaju na osnovi razlika u brzini njihova taloženja. Značenje ove teorije je u tome što ukazuje na jedinstvo građe živih bića i na njihovo zajedničko podrijetlo.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nih limfocita T koji specifično uništavaju antigen. topos = mjesto).0. Najvažnija tvar stijenke je celuloza. tanka ovojnica (7 do 10 nm) koja obavija stanicu. To je postupak izdvajanja pojedinih staničnih organela ili još manjih dijelova stanice u zasebne homogene frakcije da bi se bolje upoznala njihova fiziološka uloga i biokemijski sastav. protiskivanjem stanica kroz uski prostor određenih dimenzija. skupina od oko 30 000 vrsta gljiva u koje spadaju i sve one što ih u svakodnevnom govoru zovemo gljive. STANIČNA MEMBRANA. STANLEY. STANIČNI CIKLUS. teorija po kojoj sva živa bića imaju staničnu građu. STANIČNA JEZGRA. Građena je od proteina i lipida pa se naziva još i lipoproteinska ovojnica. a samo u gljiva celuloza je nadomještena hitinom. centrioli. disanje. kromosomi. Utemeljitelji ove teorije su njemački znanstvenici. specifično građene strukture unutar stanice koje su obavijene membranom i obavljaju određenu funkciju. mitohondrij. endoplazmatska mrežica.

južnoamerički nandu i australski emu. hormon rasta. jednostanične ili všestanične. afrički noj. oštećenja membrana lizosoma. Uz različite druge spore. Pokreće se imunološka reakcija. list i cvijet). v. zupčarke (prosenjak). imunizacija. STEROIDI. STONOGE. niže biljke. Šumske gljive žive u mikorizi s drvećem. STIGMA. Obuhvaćaju različite organizme nazvane jednim imenom ALGE. STERILIZACIJA. Starenje i umiranje nekih stanica započinje zapravo odmah nakon začeća i traje sve do smrti iako se najčešće pod starenjem podrazumijevaju procesi koji nastaju nakon pedesete godine. tkiva i organa. humoralna i stanična imunost. Patološki razlozi starenja posljedica su težih oštećenja pojedinih organa. STELJKA (talus). Dva su osnovna oblika stečene imunološke reakcije. puhare itd. Kod mekušaca većinom se nalaze u stopalu. prvenstveno vodeni organizmi pa cijela njihova površina sudjeluje u primanju vode i izmjeni tvari. zelena pupavka). rupičarke (vrganji). isp. snijeti. U organizmu čovjeka poznati steroidi su spolni hormoni. izlaganje supstrata temperaturi iznad 100 oC i više pri čemu ugibaju ne samo bakterije već i njihove spore. smanjenje regeneracijskih sposobnosti oštećenih stanica itd. U stanicama se zbiva niz fizioloških promjena. nakupljanje štetnih tvari. gubitak vode zbog čega se mijenjaju bjelančevine u citoplazmi.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE dišta su im najčešće oblika kišobrana ili klobuka na stručku. STATOCISTI. Stapčarke imaju raznolike skupine. Broj mjehurića može biti od jednog do nekoliko. STH. v. organeli u protoplazmi praživotinja pomoću kojih izbacuju suvišnu tekućinu iz tijela i na taj način održavaju osmotsku ravnotežu. mekušaca i rakova. STARENJE. npr. sve promjene koje nastaju u odrasloj dobi kada se nepovratno mijenja građa i funkcija stanica. v. bazidiju. npr. npr. To je značajno za praživotinje slatkih voda jer voda zbog osmotskog tlaka neprestano ulazi kroz membranu u tijelo i razrjeđuje koncentraciju anorganskih i organskih tvari u protoplazmi. vitamin D. velike kopnene ptice koje ne mogu letjeti jer im je prsna kost bez grebena. STAROČELJUSKE (bezgrebenke). talofiti. Jednostavne su građe. Na 135 . STEČENA IMUNOST (specifična). hormoni kore nadbubrežne žlijezde i neki vitamini. organski spojevi iz skupine lipida. Nositelji te vrste imunosti su limfociti (B i T). v. Specifična imunost može biti stečena aktivno i pasivno. a najvažniji su fiziološki i patološki. STERKOBILIN B. STOME. uzdušnice i očna pjega. To su npr. Postoji niz pretpostavki o uzrocima starenja. npr. To objašnjava zašto steljnjače nemaju tijelo razlučeno u tkiva i organe. eritrociti. jednostavno građeni uzdušnjaci iz skupine člankonožaca. STEŽLJIVI MJEHURIĆI (kontraktilna vakuola). oblik otpornosti organizma koja nastaje nakon unosa antigena u organizam. puči. osjetila za ravnotežu kod nekih beskralježnjaka. kariogamijom se razvijaju i posebne – bazidiospore i to po 4 na zajedničkoj stapci. a s vremenom nastupa i smrt. v. biljno tijelo jednostavne građe na kojemu se ne razlikuju pojedini vegetativni organi (korijen. lističarke (pečurka. STELJNJAČE. stabljika.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

kolutićima imaju 1 ili 2 para člankovitih nogu, ukupno i do 200 pari. Na glavi su ticala i jednostavne oči. Žive na vlažnim staništima. Poznate su strige i dvojenoge.
STRATIGRAFSKA GEOLOGIJA (povijesna geologija), znanost koja proučava razvojni put Zemlje od postanka litosfere do danas. STREPTOKOKI, v. bakterije. STROBILA, v. trakavica. STROMATOLITI, tvorevine posebne građe u kojima se nalaze fosilizirane bakterije i cijanobakterije. STUPANJ OTROVNOSTI (toksicitet), količina otrova koja ubija 50 posto otrovanih jedinki. To je tzv. 50 %-tna letalna doza ili LD50. SUKCESIJE, procesi smjenjivanja čitavih biocenoza na nekom prostoru. SUKCESIVNA EVOLUCIJA (filetička, susljedna), postupno nakupljanje malih nasljednih promjena i novih svojstava organizama te postupan prijelaz jedne vrste u drugu. SUNAŠCE, v. korjenonošci. SUSLJEDNA EVOLUCIJA, v. sukcesivna evolucija. SVINJSKA TRAKAVICA, nametnik u crijevu čovjeka, (isp. trakavice). Čovjek se zarazi ako pojede njezinu ikricu s mesom zaražene svinje. Iz ikrice se razvije trakavica. Stražnji zreli članci s oplođenim jajnim stanicama se otkidaju i izlaze iz crijeva čovjeka. Ako te članke pojede svinja, u njezinu crijevu će se razviti ličinke koje se u mišićima začahure stvarajući ikricu. SVITAK (horda, chorda dorsalis), potporni savitljivi prutić sastavljen od vezivnog tkiva. Proteže se na leđnoj strani duž čita-

vog tijela iznad crijeva i ulazi u glavu. U embrionalnom razvitku razvija se iz endoderma. Plaštenjaci imaju svitak samo u stadiju ličinke, a svitkoglavci u svim stadijima razvitka.
SVITKOGLAVCI (Cephalochordata), pripadaju bezlubanjcima iz koljena svitkovci. Najpoznatija skupina su kopljače. Žive u morima. Uvijek imaju svitak. Mišići, organi za izlučivanje i krvotok te škržne pukotine na ždrijelu imaju kolutićav raspored. Živčani je sustav cjevast i proteže se iznad svitka s leđne strane tijela. Kopljača je razdvojena spola. Oplodnja je vanjska. U Jadranskom moru živi zašiljena kopljača koja obitava u pijesku, a i pliva. U Tihom oceanu živi kalifornijaka kopljača. U Kini kopljača služi kao hrana. SVITKOVCI (Chordata), životinje koje na leđnoj strani (ispod živčanog sustava, a iznad crijeva) imaju svitak ili hordu, isp. Svitkovci su dvobočno simetrične životinje bez znakova vanjske kolutićavosti. Naseljavaju sva staništa u vodama i na kopnu. Danas živi oko 45000 vrsta. Svitkovcima pripadaju tri potkoljena: plaštenjaci, svitkoglavci i kralježnjaci. Plaštenjaci i svitkoglavci su bezlubanjci, a kralježnjaci su lubanjci. Preci svitkovaca su davni srodnici žiroglavaca ili polusvitkovaca, isp. Osnovna obilježja svih svitkovaca jesu, osim svitka, i škržne pukotine na prednjem dijelu probavila. Kod viših kralješnjaka postaju prave škrge ili pluća. Dalje, živčani sustav je s leđne strane trupa. U kralješnjaka se razvija u leđnu moždinu koja je smještena u kralješnici. Na prednjem dijelu leđne moždine razvija se mozak, u lubanjaca zaštićen hrskavičnom ili koštanom lubanjom. Optjecajni (krvožilni) sustav je zatvoren, sa srcem s trbušne strane. SVOJTA, filogenetske sustavske jedinice bez obzira na njihov stupanj. Svojte koji-

136

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ma označujemo različite oblike nekih vrsta koje je čovjek postigao na umjetan način, tj. uzgojem su kultivar, sorta, klon i linija.

ultrazvuk kojim pronalaze hranu i lakše se snalaze u prostoru.
ŠKOLJKAŠI,. pripadaju skupini mekušaca, isp. Većinom žive u moru, npr. dagnje, prstaci, periske. U slatkim vodama najpoznatija je bezupka. Tijelo im je bočno spljošteno i smješteno između dviju ljuštura. Ljušture su spojene zubićima i ligamentom, a otvaraju ih i zatvaraju mišići zatvarači. Stopalom se pričvršćuju za podlogu. Između plašta i tijela je plaštena šupljina u koju stalno ulazi voda. Filtrirajući vodu školjkaši dolaze do hrane i kisika. Nemaju radulu. Većina su rastavljenog spola. Oplodnja je vanjska. ŠKORPIONI, v. paučnjaci. ŠKRGE, organi za disanje kod kružnousta, riba i ličinke vodozemaca. Nastaju u području škržnih pukotina u ždrijelu. Škrge su u obliku resa (škržni listići) i dobro su prokrvljene krvnim kapilarama. Voda ulazi kroz usta i oplakuje škržne listiće. Otopljeni kisik iz vode difuzijom prelazi u krv, a iz krvi izlazi ugljik dioksid. ŠKROB, složeni organski spoj iz skupine polisaharida koji sadrži kemijski vezano nekoliko stotina molekula glukoze. Opća formula mu je (C6H10O5)n. On je pričuvni polisaharid biljaka koji se u obliku škrobnih zrnaca nalazi u spremišnim organima biljaka (zadebljali dijelovi korijena, lukovice, gomolji itd.). U slučaju kada su ugljikohidrati potrebni i kao izvor energije u stanicama, škrob se postupno razgrađuje uz pomoć niza enzima (npr. amilaze, maltaze) do glukoze koja zatim ulazi u proces staničnog disanja. U ljudskom organizmu prvi se počinje probavljati, v. probava. ŠTIPALJKE (pedicelarije), nalaze se, kod bodljikaša, između bodlji (npr. kod ježinaca i zvjezdača). Služe za obranu, hvatanje plijena i čišćenje.

Š
ŠARENICA (iris), v. bjeloočnica. ŠARLAH (scarlatina, škrlet), akutna zarazna bolest uzrokovana bakterijama (streptokokima). ŠEĆERI, v. ugljikohidrati. ŠEĆERNA BOLEST (dijabetes), bolest koja nastaje zbog smanjenja ili potpunog izostanka izlučivanja hormona inzulina beta stanicama Langerhansovih otočića u gušterači. Nedostatkom inzulina u krvi nastaje povećana razina šećera u krvi (hiperglikemija), a istovremeno nedostatak šećera za energetske potrebe u stanicama. Kod bolesnika s smanjenom proizvodnjom inzulina daju se lijekovi koji stimuliraju gušteraču na pojačano lučenje inzulina. Kod težeg oblika dijabetesa, tzv. inzulin ovisan dijabetes daju se injekcije inzulina. Bolesnici se moraju strogo držati ugljikohidratne dijete. Bolest se javlja u djece (juvenilni dijabetes) i u odraslih (adultni dijabetes). ŠEŠVA, v. boginje. ŠIŠMIŠI (netopiri), jedina skupina sisavaca koji mogu letjeti. Krila imaju letnu kožicu ili letnicu razapetu između dugačkih kosti prstiju. Kada se odmaraju, pričvrste se stražnjim nogama za stijenu i vise glavom prema dolje. Neki spavaju zimski san. Hrane se kukcima ili malim kralježnjacima, voćem, nektarom, peludom, a neki sišu krv. Šišmiši ispuštaju

137

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ŠTITARKE, skupina uglavnom zeljastih biljaka dvosupnica. Listovi su im razdijeljeni, stabljika je šuplja, a cvijetovi skupljeni u štitac. U svim dijelovima, naročito u plodićima, sadrže aromatične i ljekovite tvari pa se štitarke rabe u prehrani, farmaciji i kao začinske biljke. Neke od njih su: mrkva, peršin, celer, kopar i kim. ŠTITNA ŽLIJEZDA (štitnjača), žlijezda s unutarnjim izlučivanjem, smještena je ispod grkljana s obje strane dušnika. Žlijezdane stanice štitnjače izlučuju hormone tiroksin (T4), trijodtironin (T3), tireokalcitonin i dr. Ti hormoni stimuliraju metabolizam u tijelu. U svom sastavu imaju jod. ŠULJEVI (hemoroidi), proširene vene na kraju zadnjeg crijeva (rektum) i čmara. Vene oteknu zbog učestalo povišenoga tlaka, što je obično posljedica opetovanog naprezanja prilikom ispražnjivanja crijeva. Hemoroidi mogu biti unutarnji i vanjski. Prolaskom fekalija mogu lako popucati i krvariti. ŠUPLJE VENE, gornja i donja, najveće vene, ulaze u desnu pretklijetku srca. Nemaju venskih zalisaka, v. veliki optok. ŠUPLJINA, v. celom.

njuje vrijeme predviđeno za odmor srčanog mišića.
TAKSIJA, vrsta lokomotornog gibanja biljaka čiji je smjer gibanja ovisan o smjeru vanjskog podražaja. Kreću li se organizmi u smjeru podražaja, gibanja nazivamo pozitivnom taksijom, a ako se organizmi kreću od izvora podražaja, gibanja nazivamo negativnom taksijom. Prema podražajima koji ih uzrokuju razlikujemo: kemotaksije (uzrokovane kemijskim tvarima), fototaksije (reakcije na svjetlost), tigmotaksije (izazvane dodirom), hidrotaksije (reakcije na vlagu), termotaksije (izazvane temperaturom) i geotaksije (podražaj je sila teže). Taksije su osobito važne za mnoge jednostanične organizme koji se kreću bičevima, trepljama, ameboidalno ili kližu po podlozi. TAKSIN, v. tise. TAKSON, isto što i svojta. TAKSONOMIJA, (grč. taksis = raspored, poredak + nomos = zakon) znanost o zakonima razvrstavanja organizama, hijerarhija sistematskih kategorija (vrsta, rod, porodica, red, razred, odjeljak/koljeno, carstvo), isp. filogenetski (prirodni) sustav i sistematika. TALUS, v. steljka. TANKO CRIJEVO, cjevasti organ probavnog sustava koji se proteže od želuca, a nastavlja debelim crijevom. Ukupna dužina iznosi 5 do 6 metara. Sastoji se od: početnog dijela – dvanaesnika (duodenum), srednjeg dijela (jejunum) i krajnjeg dijela (ileum). Unutarnja površina crijeva sadrži crijevne resice. Sluznica tankog crijeva ima brojne žlijezde a to su: Brunnerove žlijezde koje se nalaze na početnom dijelu duodenuma i luče sluz koja štiti crijevnu stijenku od probavnog djelovanja želučanog soka prije neutralizacije himusa u

T
T - LIMFOCITI, vrsta leukocita koji nastaju najviše u timusu (prsnoj žlijezdi), a manje u limfnim čvorovima i slezeni. Oni su jedni od nositelja stanične specifično stečene imunosti. TAHIKARDIJA, nagli porast frekvencije srca s prosječnih 70 otkucaja u minuti na 100 i više. Tahikardija je štetna jer se sma-

138

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

dvanaesniku; Liberkühnove kripte su žlijezde koje se osim u duodenumu nalaze po cijeloj površini tankog crijeva i luče sluz i crijevni sekret.
TARAXACUM OFFICINALE, stručni latinski naziv za maslačak. TARTUFI (gomoljače), gljive mješinarke, rastu petnaestak centimetara pod zemljom u listopadnim šumama. Kulinarski su specijalitet posebne arome pa ih ljudi pronalaze uz pomoć dresiranih pasa ili svinja. TELOCENTRIČAN KROMOSOM, kromosom s pričvrsnicom na svom kraju. TELOFAZA, završna faza stanične diobe, mitoze. U telofazi se kromosomi koji su stigli na suprotne polove stanice počinju despiralizirati i oko njih nastaje jezgrina ovojnica. Dvije novonastale stanice imaju diploidan broj kromosoma, a svaki kromosom je građen od jedne kromatide. U stanicama se formiraju jezgra i jezgrica. TELOFAZA DRUGE DIOBE, v. telofaza II. MEJOTIČKE

TEPALA, v. cvijet. TERMONASTIJE, v. nastije. TERMOREGULACIJA, održavanje stalne tjelesne temperature čovjeka i homeotermnih životinja. U čovjeka središta za regulaciju tjelesne temperature nalaze se u hipotalamusu. Sastoje se od središta za "produkciju" i središta za "redukciju" topline. Ako je tijelo pregrijano, uključuje se središte za redukciju topline koje šalje informacije živčanim putovima na periferiju. Dolazi do širenja krvnih kapilara (vazodilatacija), povećava se dotok krvi u kožu pa se toplina otpušta u okoliš. Stezanjem žlijezda znojnica oslobodit će se znoj koji isparavanjem hladi kožu. Hormonalnim putem regulirat će se smanjenje razgradnje hranjivih tvari i time smanjiti proizvodnja topline. Ako je tijelo pothlađeno, aktivira se središte za produkciju topline. Tada prestaje znojenje, krvne kapilare se stežu (vazokonstrikcija), smanjuje se protok krvi u koži, a hormonima (tiroksin) stimuliraju se kataboličke reakcije. TEST KRIŽANJE (povratno križanje), križanje koje se koristi kada se želi provjeriti da li su jedinke F2 generacije homozigotne (npr. AA) ili heterozigotne (npr. Aa) za određeno svojstvo jer se razlika ne može zamijetiti po fenotipu. Jedinka nepoznatog genotipa se križa s recesivnim homozigotom (aa). Ako su svi dobijeni potomci dominantnog tipa, testirana jedinka je bila homozigotna, a ako je 50 % dominantnih i 50 % recesivnih, jedinka je bila heterozigotna. (v. shemu u Dodatku 1.) Test križanje može se koristiti i ako se želi provjeriti genotip jedinki F2 generacije koje su nastale dihibridnim križanjem s dominacijom. U tom slučaju jedinka nepoznatog genotipa križa se s recesivnim homozigotom za oba svojstva (aabb). Ako je testirana jedinka bila homozigotna za oba svojstva (AABB), dobiveni

TELOFAZA I (telofaza prve mejotičke diobe), završna etapa mejoze I u kojoj su vidljive dvije novonastale stanice s haploidnim brojem kromosoma koji su građeni od dvije kromatide. Kromosomi se despiraliziraju, a oko njih se formira jezgrina ovojnica. U stanicama postaju vidljive jezgra i jezgrica. TELOFAZA II (telofaza druge mejotičke diobe), završna etapa mejoze II u kojoj nastaju četiri stanice s haploidnim brojem kromosoma od kojih je svaki kromosom građen od jedne kromatide. Oko despiraliziranih kromosoma formira se jezgrina ovojnica te nastaju jezgra i jezgrica. TELOFAZA PRVE MEJOTIČKE DIOBE, v. telofaza I. TENTAKULA, ticalo, isp. virnjaci.

139

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

će potomci biti dominantnog tipa, a ako je bila heterozigotna za oba svojstva (AaBb), dobit će se omjer fenotipova 1/4:1/4: 1/4: 1/4. (v. Dodatak 1.)
TESTISI, v. sjemenici. TESTOSTERON, muški spolni hormon kojega izlučuju intersticijske stanice sjemenika. Manje količine testosterona izlučuju se već u embrionalnoj i fetalnoj dobi, a veće količine u pubertetu. Utječe na razvoj primarnih i sekundarnih spolnih obilježja muškaraca. Izlučivanje testosterona pod kontrolom je gonadotropnih hormona iz prednjeg režnja hipofize. TETRADA, grupa od četiri kromatide u mejozi, v. profaza I. TETRAPLOIDNI BROJ KROMOSOMA, v. poliploidija. TIGMONASTIJA, v. nastije. TIGMOTROPIZAM, v. tropizam. TILAKOIDI, sustav membrana u unutarnjosti kloroplasta (isp.) i drugih plastida. TILAKOIDNE MEMBRANE, specifično građene membrane koje se nalaze u unutarnjosti kloroplasta i drugih plastida. Mogu sadržavati različita biljna bojila (klorofil, karotene, ksantofile) ovisno o tipu plastida u kojima se nalaze. U tilakoidnim membranama koje sadrže klorofil odvija se fotosinteza. TIMIN, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo DNA. Strukturna formula mu je:
O H O N C C N H C C CH 3 H

TIMPANALNI ORGANI, osjetila za sluh kod kukaca. Smješteni su na različitim dijelovima tijela. To su udubine u kutikuli prekrivene timpanalnom membranom ili bubnjičnom opnom. Opne titraju podražene zvukom, a titranje primaju osjetne stanice i podražaj dalje prenose u moždana središta. TIMUS (prsna žlijezda), smješten je u prsnoj šupljini iznad dušnika i srca. U embrionalno i fetalno doba pa sve do puberteta, to je najveći proizvođač limfocita, koji su po timusu i dobili prefiks T – limfociti. TIREOKALCITONIN, hormon štitne žlijezde koji regulira koncentraciju iona kalcija u krvi i potiče ugradnju kalcija (i fosfora) u kosti. TIREOSTIMULACIJSKI v. tireotropni hormon. HORMON,

TIREOTROPNI HORMON (tireostimulacijski hormon, TSH), hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a koji potiče rast štitne žlijezde i izlučivanje tiroksina. TIROKSIN (T4), hormon kojega izlučuje štitna žlijezda, a stimulira cjelokupni metabolizam u organizmu, v. štitna žlijezda. TIROZIN, kemijski spoj iz skupine aminokiselina. TISE, porodica biljaka iz skupine četinjača (golosjemenjača). Listovi su plosnati. Sjemenke se nalaze unutar mesnatog ovoja (arilus) koji sadrži hranjive tvari. Ostali dijelovi tise sadrže taksin (otrovni alkaloid). U hrvatskoj flori zastupljena je s jednom vrstom: običnom tisom koja je zaštićena jer je rijetka i ugrožena na prirodnim staništima . TJELESNA STANICA (somatska stanica), osnovna građevna jedinica višestaničnih organizama. Nastaje diobom mitozom

140

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

od stanice majke, a njen životni vijek traje dok se i ona mitotičkom diobom ne podijeli u dvije nove stanice kćeri. Razdoblje u životu stanice između dviju dioba naziva se interfaza.
TJELESNI (somatski) ŽIVČANI SUSTAV, prima i prenosi različite osjete (i svjesno zapažanje), te upravlja radom mišića. Sastoji se od središnjeg živčanog sustava (kojem pripadaju mozak i leđna moždina) i perifernog živčanog sustava tj. perifernih živaca. TJEMENO OKO (parijetalno oko, tjemeni organ), mjehurić sličan oku kod nekih gmazova, npr. premosnika i gušterice. Sastoji se od osjetnih stanica za svjetlo i pigmentnih stanica. Unutarnjost mjehurića ispunjena je staklastim tijelom. Na lubanji je iznad mjehurića otvor koji je presvučen prozirnom kožicom kroz koju pada svjetlost na tjemeni organ. TKIVNI MAKROFAGI, stanice sa sposobnošću fagocitoze, nastaju iz monocita koji su iz optoka krvi došli u tkiva. Nalaze se npr. u jetri i slezeni i nemaju mogućnost ameboidnog kretanja. TMV, v. virus mozaične bolesti duhana. TOBOLČARI, primitivni sisavci koji se razvijaju unutar majčina tobolca. U tobolac se otvaraju mliječne žlijezde. Ženke tobolčara imaju kratkotrajnu trudnoću te rađaju male i slabo razvijene mlade. Razvitak u tobolcu traje nekoliko puta dulje od razvitka u majčinom tijelu. Danas u biosferi živi oko 200 vrsta. Poznatiji su: klokan, koala, oposum i psoglavi vučak. TOKSICITET, v. stupanj otrovnosti. TOKSIČNI ELEMENTI (otrovni elementi), elementi kao što su živa, olovo, kadmij, radioaktivni izotopi itd. Oni se najčešće javljaju u otpadnim tvarima industrije, prometa itd. Slijedom hranidbenih

lanaca postupno se nakupljaju u pojedinim dijelovima organizma postižući koncentraciju koja je za organizam toksična, otrovna.
TOKSIČNOST, v. otrovnost. TOKSINI, otrovi živih organizama, a mogu biti bakterijskog (bakteriotoksini), gljivičnog (mikotoksini), životinjskog (zootoksini) i biljnog (fitotoksini) porijekla. TONOPLAST, u biljnoj stanici granični sloj plazme prema vakuoli. TORNARIJA, ličinka žiroglavaca iz skupine malokolutićavaca. TOTIPOTENTNOST, mogućnost diferencirane somatske stanice da sačuva potencijal razvitka čitavog novog organizma, v. klon. Stanična diferencijacija često je povratna (reverzibilna), a dediferencirane (ponovo nediferencirane) se stanice mogu opet dijeliti i po potrebi regenerirati čitavu biljku (osobito kada se biljno tkivo uzgaja u kulturi). Pojava je rezultat regulacije aktivnosti gena. TRAHEJE, v. uzdušnice. TRAHEOLA, v. udušnice. TRAKAVICA, beskolutićava životinja koja pripada koljenu plošnjaka, isp. Žive kao nametnici u probavilu kralježnjaka. Tijelo im je plosnato i pokriveno kutikulom, dugačko i 15 m. Na prednjem dijelu je "glava" (skoleks) s kukicama i prianjalkama te vrat i tjelesni članci (proglotidi) koji tvore strobilu. Trakavice su anaerobni organizmi i nemaju organa za disanje ni optjecanje. Nemaju ni probavilo već hranu uzimaju osmotski preko površine tijela. Dvospolci su. Svaki proglotid sadrži muške i ženske rasplodne organe. Imaju hiperprodukciju potomaka. Tijekom života trebaju barem jednog međudomadara. Najpoznatije trakavice su goveđa, svinjska i pasja trakavica ili ehinokok.

141

presađivanje tkiva ili organa na drugo mjesto istog organizma ili na drugi organizam. tRNA. Proces transpiracije je važan pokretač za kretanje vode kroz biljku. Oblici masovnog transporta su endocitoza i egzocitoza. 142 . Na površini pelikule imaju trepetljike ili cilije. TRANSKRIPCIJA. Svi trepetljikaši imaju barem 2 jezgre: malu jezgru mikronukleus i veliku jezgru – makronukleus. mora se nakon presađivanja tkiva imunološki sustav primatelja zakočiti svakodnevnim uzimanjem lijekova koji slabe imunoreakciju. MASOVNI. U nefronima se stvara mokraća koja kroz mokraćovod ulazi u nečisnicu ili kod sisavaca u mokraćni mjehur. kroz puči (stome) .lenticelna transpiracija. sinteza proteina.stomatalna tranpiracija. v. uzrokovana je komadićem molekule DNA koji sadrži gen. Osnovna anatomska jedinica bubrega je nefron. TRANSLOKACIJA. TREĆI BUBREG (pravi bubreg ili metanefros). TREONIN.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ TRANSDUKCIJA. organ za izlučivanje kod gmazova. Najprepoznatljiviji su papučice (parameciji) i zvončići (vorticele). Vrlo su pokretljivi. prebacivanje segmenta jednoga kromosoma na drugi nehomolog.drugi bubreg. Također može spriječiti pregrijavanje biljke. Rijetko su nametnici. TRANSPIRACIJA. Da ne bi došlo do odbacivanja presađenog organa ili tkiva davatelja zbog pokretanja imunološke reakcije na strani antigen. specifičan način transporta kroz staničnu membranu kada se transportiraju velike molekule ili krute čestice koje zbog svoje veličine ne bi mogle proći kroz staničnu membranu na drugi način. najveća skupina praživotinja. a koji se oslobađa iz mrtvih bakterija i ugrađuje u žive bakterije. Isparavanje vode s vanjskih površina biljke naziva se kutikularna transpiracija. Trenica je "jezik" pokriven rožnatim zubićima kojima životinje stružu čestice hrane po podlozi. v. TRANSFER RNA. v. tRNA. TRANSLACIJA. isp. ptica i sisavaca. Žive u moru i slatkim vodama. Uzročnik bolesti je bakterija Salmonella typhi koja izaziva upalu crijevnih stijenki. TREPETLJIKAŠI. Imunološki sustav organizma prepoznaje svoje bjelančevine kao vlastite i na njih ne reagira (imunološka tolerancija). TRENICA (radula). Inkubacija traje od 7 do 14 dana. Bubrežne cjevčice počinju Bowmanovim čahurama. TRANSFUZIJSKA REAKCIJA. TRANSPLATACIJA. Mikronukleus ima diploidan broj kromosoma (2n) i sudjeluje u konjugaciji. zatvorom u prvoj fazi. a eventualno proljevom u drugoj. sinteza proteina. Novougrađeni gen daje bakteriji nove osobine. v. Transfuzijsku reakciju karakterizira sljepljivanje (aglutinacija) i raspadanje (hemoliza) eritrocita. TRANSPORT. te se krvotokom prenosi po cijelom tijelu. reakcija koja nastaje prilikom transfuzije krvi. prijenos genetičkog materijala jedne bakterije u drugu virusom. TRANSPORTNA RNK. kada se krvna grupa davatelja ne podudara s krvnom grupom primatelja krvi. kemijski spoj iz skupine aminokiselina. struktura u usnoj šupljini mekušaca (puževa i glavonožaca) za mrvljenje hrane. TRANSFORMACIJA STANICA. TRBUŠNI TIFUS (tifus) je akutna zarazna crijevna bolest s temperaturom. izlučivanje (isparavanje) vode iz biljaka u obliku vodene pare. a kroz lenticele . Mokraćovod nastaje iz donjeg dijela Wolfove cijevi.

Njena je uloga da veže na sebe odgovarajuće aminokiseline i prenosi ih na ribosom gdje će se sintetizirati proteini. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima. Ispunjeni su sekretom koji se na podražaj izbacuje van. I u ovom slučaju. vrsta ribonukleinske kiseline koja se nalazi u citoplazmi. osmoregulacijom). TRIPLET. vanjski sloj stanica blastociste čovjeka i ostalih sisavaca. U ovdje navedenom primjeru parentalnu generaciju predstavlja biljka visokog rasta. jedan od probavnih enzima kojega izlučuje gušterača u početni dio tankog crijeva (dvanaesnik. TRIHIBRIDNO KRIŽANJE S DOMINACIJOM. kemijski spoj iz skupine aminokiselina. Nastaje u jednoj od etapa embrionalnog razvitka. mogući su sljedeći fenotipovi: 1. niski. a sudjeluje u razgradnji bjelančevina do aminokiselina. Obje biljke su homozigoti za navedena svojstva s tim da su svojstva: visoki rast. žutih naboranih sjemenki-1 (V. tRNA (transportna RNK ili tRNK. TRIPANOSOMA.) TRIHOCISTI. Javlja se u tropskom području Afrike. zelena boja sjemenke i glatka površina sjemenke dominantna. žutih i naboranih sjemenki. zelenih i glatkih sjemenki i biljka niskog rasta. TRIJODTIRONIN (T3). visoki. v. duodenum). TROFOBLAST. Trepetljikaši se najčešće razmnožavaju dvojnim ili binarnim dijeljenjem. Križanjem takvih biljaka dobiva se F1 generacija čije su sve jedinke istog fenotipa: visokog rasta. zelenih naboranih sjemenki-3 7. blastulaciji. a recesivni malim. žutih glatkih sjemenki-9 4. a njihovim međusobnim križanjem dobivamo F2 generaciju koja može imati 8 različitih fenotipova. niski. TRISOMIK. a generacije potomaka (filijalne) prema redoslijedu s F1 i F2. v. posebni mjehurići koji se nalaze u donjem sloju pelikule. početna roditeljska (parentalna) generacija se označuje s P. prijenosna RNK. izmjenom plinova. zelenih glatkih sjemenki 9 6. TRIPSIN. a svaka se odlikuje sposobnošću da veže na sebe samo jednu određenu aminokiselinu. jednostanična životinja (praživotinja) iz skupine bičaša koja u čovjeka uzrokuje smrtonosnu bolest spavanja.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Makronukleus upravlja drugim životnim aktivnostima (hranjenjem. štitna žlijezda. visoki. Građena je od 80-ak nukleotida pa je po veličini najmanja vrsta RNA. Jedinke F1 generacije mogu stvarati 8 različitih tipova gameta. Postoji 20 različitih vrsta molekula tRNA. transfer RNA). v. bičaši. visoki. tj. niski. shemu u Dodatku 1. križanje u kojem se prati nasljeđivanje triju svojstava. poliploidija. Trofoblast okružuje unutarnji sloj stanica (embrioblast). visoki. žutih glatkih sjemenki-3 8. TRIHOMONAS. zelenih naboranih sjemenki-9 3. kao i u ostalim prikazima križanja. stanica. TRIPTOFAN. tkivo ili organizam koji ima uz homologni par još jedan kromosom viška (2n+1). zelenih i glatkih sjemenki. Ona sačinjava 10 do 15 % ukupne stanične RNA. TRIPLOIDNI BROJ KROMOSOMA. zelenih glatkih sjemenki-27 2. Iz stanica trofo- 143 . niski. Omjer fenotipova u F2 generaciji je: 27:9:9:3:9:3:3:1. v. Ti organeli služe za obranu i zaštitu praživotinja. kodon. žutih naboranih sjemenki-3 5.

oko 16 dana nakon oplodnje. krvni ugrušak. Trudovi se u početku pojavljuju svakih 15 do 20 minuta. Prema vrsti podražaja koji uzrokuju ova gibanja razlikujemo fototropizam (gibanje rastenjem uzrokovano jednostranim djelovanjem svjetlosti). razdoblje od oplodnje do rođenja. U jednostavnijih oblika mekušaca trohofora se razvija u odraslu jedinku. npr. kod plućne embolije dio se krvnog ugruška zaustavi u plućima ili kod infarkta srca (isp. velinger linčiku. saharoza. ozljede krvnih žila i dr. Trudnoća u žene traje u prosjeku 280 dana ili 40 tjedana. v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ blasta i decidua stanica (stanice sluznice maternice). TROPOSFERA. TROMBOCITOPENIJA. započinje razvoj posteljice koja će osigurati prehranu zametka u kasnijoj fazi embrionalnog razvitka. nenormalno stvaranje ugrušaka krvi (tromba) u žilama (venama ili arterijama) zbog različitih uzroka (ateroskleroza. TROFOGENI SLOJ. tzv. TROJKA. TROHOFORA. TROMB. u sisavaca. TROPIZAM. te djelomično ili potpuno začepiti neku užu krvnu žilu. antibiotici. u moru do 200 m. ličinka kod mekušaca i morskih kolutićavaca.). a negativan ako se giba od izvora podražaja. bolest kod koje je smanjen broj krvnih pločica – trombocita. Tijekom trudnoće zbivaju se različite hormonalne promjene. isp. v. ima vijenac trepetljika te može slobodno plivati. biljke i životinje. TRUDNOĆA. Imaju važnu ulogu u kontroli krvarenja sudjelujući u procesima zgrušavanja krvi nakon ranjavanja. a mnogi imaju kasniji stadij ličinke. npr. Trudovi su uzrokovani izlučivanjem hormona oksitocina kao i povećanim izlučivanjem estrogena i to iznad vrijednosti progesterona. površinski osvjetljeni sloj. citoplazmatski dijelovi velikih stanica megakariocita iz kojih se oslobađaju raspadanjem. izlučuje se više progesterona nego estrogena što sprječava pojavu menstruacije koja dovodi do gubitka ploda. protuupalni lijekovi i dr. ateroskleroza. ljepljeći se za ozljeđeno mjesto zajedno s fibrinogenom i krvnim stanicama. TROMBOCITI (krvne pločice). Razvija se iz oplođene jajane stanice. a u kopnenim vodama stajačicama do oko 50 m. geotropizam (gibanje kojim biljke dovode svoje organe u određeni položaj prema sili teže). jedna vrsta gibanja biljnih organa u obliku svijanja uzrokovana i usmjeravana jednostranim vanjskim podražajima. infarkt. TRUDOVI. Pozitivan je tropizam ako se organ giba prema izvoru podražaja. TROMBOZA. u kojem se odvija proces fotosinteze i primarne organske proizvodnje (bioproizvodnje). Tromb može potpuno ili djelomično spriječiti protok krvi kroz žilu ili se može otkinuti od hvatišta na stijenci žile i slobodno kolati po tijelu (embolus). To stanje mogu uzrokovati pojedini lijekovi. Do svijanja dolazi redovito zbog različito jakog rastenja suprotnih strana organa. TRŠĆANI ŠEĆER. pravilna ritmička stezanja i opuštanja mišića maternice koja će uzrokovati potiskivanje ploda kroz porođajni kanal. Npr. začepljuju otvor. kemotropizam (izazvan kemijskim tvarima) i tigmotropizam (uzrokovan mehaničkim podražajima). najniži sloj atmosfere gdje žive mikroorganizmi. genetička uputa. kasnije sva- 144 .) u srčanom mišiću što uzrokuje neprokrvljenost dijelova pluća i srca te odumiranje tih dijelova.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ke dvije do tri minute, a traju 30 do 60 sekundi.
TRUSKOVCI, nametničke praživotinje. Razmnožavaju se nespolno truskama ili sporama i spolno. Najpoznatiji truskovci su plazmodiji, uzročnici malarije u čovjeka. Također su nametnici na mnogim bezkralježnjacima i kralježnjacima. TSH, v. tireotropni hormon. TUBA UTERINA, v. jajovod. TUBERKULOZA (sušica), teška zarazna bolest uzrokovana Kochovim bacilom, bakterijom štapićastog oblika. Uzrokuje oštećenja tkiva pluća. TUČAK, ženski dio cvijeta. Nastao je sraštavanjem jednog plodnog lista (megasporofila) ili više njih. Sastoji se od plodnice, vrata i njuške. U plodnici se nalazi jedan sjemeni zametak (makrosporangij) ili više njih, u kojima se razvija makrospora (embrionska vreća). Makrosporogenezom razviti će se ženski gametofit. Nakon oprašivanja vegetativna stanica peludnog zrna klije u polenovu mješinicu koja provodi dvije spermalne stanice kroz mikropilu u embrionsku vreću. Jedna spermalna stanica oplodi jajnu stanicu. Iz diploidne zigote (2n) nastaje klica (embrij). Druga se spermalna stanica stapa s dvije središnje jezgre (stanice) embrionske vreće pa nastaje triploidna stanica (3n) iz koje se, mitotičkom diobom, razvija endosperm, isp. sjemeni zametak. TUMOR, u širem smislu svaka izraslina u organizmu, a u užem smislu novo-stvoreno tkivo karakterizirano nekontroliranim rastom stanica. TUNDRA, karakteristična biljna zajednica rasprostranjena u sjevernim polarnim područjima Zemlje, npr. Sibiru, Kanadi, Grenlandu itd. Sastoji se uglavnom od mahovina i lišajeva.

TUNICIN, organska tvar slična biljnoj celulozi, v. plaštenjaci. TURGOR (turgorski tlak), unutarnji hidrostatski tlak stanice koji pritišće plazmalemu uz staničnu stijenku biljnih stanica. Povećava se ulaženjem vode u stanicu. Kada turgorski tlak po visini postane jednak tlaku bubrenja (a po smjeru djelovanja mu je suprotan), zaustavi se ulazak vode. Turgor je važan za čvrstoću biljke. Ako biljka gubi vodu, turgorski tlak opada, stanice postaju mlohave i biljka vene. Turgorski se tlak, ovisno o organu, mijenja od 0.1 do 1.0 MPa (0.1 MPa = 1 bar). TURGORSKA GIBANJA, nastaju zbog promjena turgora u pojedinim susjednim tkivima ili slojevima tkiva nekih plodova (npr. štrcalica, nedirak). Kao posljedica velikih napetosti među tkivima dolazi do pucanja tih plodova i izbacivanja sjemenki. TURNEROV SINDROM, v. aneuploidija. TVORNO STANIČJE, meristem, tkivo koje omogućuje rast bilja. Stanice koje izgrađuju tvorno staničje su razmjerno male, bogate citoplazmom, bez vakuole, imaju veliku jezgru, stanične stijenke su tanke, a glavno im je obilježje da se dijele mitozama. Razlikujemo tjemenišne ili vršne meristeme koji se nalaze na vršcima izdanaka i korijena, bočne meristeme (kambij) koji omogućuju rast stabljike u debljinu itd. TVORNO TKIVO, v. tvorno staničje.

U
UČINAK STAKLENIKA, zadržavanje topline u atmosferi zbog stakleničkih pli-

145

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nova (naročito ugljikovog dioksida) koji upijaju toplinsko zračenje sa Zemlje umjesto da ga propuštaju u svemir. Rezultat je povećavanje prosječne temperature Zemlje ili globalno zagrijavanje.
UDARNI VOLUMEN SRCA, volumen krvi (oko 70 ml) koje srce utisne u krvotok za vrijeme jedne kontrakcije. UGLJENO DOBA, v. karbon. UGLJIKOHIDRATI, prirodni organski spojevi koji se nalaze u svim dijelovima staničnog tkiva, i kao funkcionalni i kao strukturni sastojci. Neki ugljikohidrati (pentoze) izgrađuju nukleinske kiseline. Predstavljaju i izvore i skladišta energije koja je dobijena fotosintezom od Sunca (npr. glukoza, škrob, glikogen). Definiraju se kao spojevi opće formule Cn(H2O)n. Naziv ugljikohidrat se obično upotrebljava u mnogo užem značenju i označuje tvari sastavljene od polihidroksi aldehida i ketona i njihovih derivata. Šećeri ili saharidi su tipični predstavnici ugljikohidrata. Monosaharidi su ugljikohidrati koji se obično sastoje od 3 do 9 atoma ugljika pa se prema tome mogu i svrstavati u trioze, tetroze, pentoze, heksoze itd. Najpoznatiji monosaharidi ili jednostavni šećeri su pentoze riboza i dezoksiriboza te heksoze glukoza, fruktoza i galaktoza. Povezivanjem 2 do 10 monosaharida nastaju oligosaharidi pa se prema tome mogu svrstati u disaharide, trisaharide, tetrasaharide itd. Najpoznatiji oligosaharidi su disaharidi saharoza, laktoza i maltoza. Povezivanjem više od 10 monosaharida nastaju polisaharidi. Najpoznatiji polisaharidi su škrob, glikogen, celuloza i hitin. UHO, osjetilo za sluh. Sastoji se od vanjskog, srednjeg i unutarnjeg uha. VANJSKO UHO, sastoji se od ušne školjke (uške), građene od hrskavice, od zvukovoda (vanjskoga slušnoga kanala), koji

vodi od uške do bubnjića (membrana tympani).
ULTRAMIKROELEMENTI, v. elementarni sastav. UMJETNI ELEKTROSTIMULATOR RADA SRCA, tzv. pacemaker, mali generator na baterije koji je povezan s elektrodama koje se stavljaju na stijenku srca. Električni impulsi dolaze na srčani mišić frekvencijom programiranom prije ugradnje u rahlo tkivo stijenke prsnog koša. Pacemaker se ugrađuje kod nenormalnog rada S - A čvora, v. središte automacije rada srca. UMJETNI SUSTAV, sustav u koji su svrstane jedinke u skupine s gledišta njihova korištenja, npr. samonikle i kultivirane biljke. UMNI ČOVJEK, v. Homo sapiens. UMOR MIŠIĆA, nastaje zbog nakupljanja mliječne kiseline nakon dugotrajne i snažne mišićne kontrakcije. Razlog nakupljanja mljiječne kiseline je utrošeni ATP u mišićnim vlaknima, nedostatak glukoze ili kisika. Bez kisika glukoza se razgrađuje u dvije molekule pirogrožđane kiseline koje prelaze u mliječnu kiselinu. UNUTARNJE UHO, sastoji se od pužnice (cochlea) i polukružnih kanalića važnih za održavanje ravnoteže. Pužnica je šuplji kanal, zavijena dva i pol puta. Kanal je podijeljen sa dvije tanke membrane u tri hodnika (skale). Ti su hodnici ispunjeni tekućinom (endolimfom u sredini i perilimfom u gornjem i donjem hodniku). Na donjoj pregradnoj - bazilarnoj membrani nalaze se receptori za sluh tzv. Cortijev organ koji sadržava slušne Cortijeve stanice s dlačicama. Iz Cortijevih stanica izlaze živčana vlakna koja se udružuju u slušni živac i prenose električne potencijale nastale u Cortijevim stanicama u slušnu regiju mozga (sljepoočni režanj).

146

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

UNUTARNJI FAKTOR, luči ga pilorusni dio želuca. Omogućuje apsorpciju vitamina B 12 u tankom crijevu. Taj vitamin je važan u proizvodnji eritrocita. Nedostatak unutarnjeg faktora uzrokuje anemiju. UPALA CRVULJKA (apendicitis), nastaje kod zastoja crijevnog sadržaja u šupljini crvuljka. Upalu mogu izazvati i strana tijela (koštice) ili paraziti koji uđu u crvuljak. Crvuljak se upali i ispuni gnojem uz pojavu jake boli u donjem desnom dijelu trbušne šupljine. Liječi se brzim kirurškim odstranjivanjem upaljenog crvuljka (apendektomija). UPALA GUŠTERAČE (pankreatitis), vjerojatno nastaje djelovanjem probavnih gušteračinih enzima na samo tkivo gušterače. Kod upale se javlja izrazito jaka bol u gornjem dijelu trbušne šupljine. Bol se širi u leđa i prsni koš, uz povraćanje i jaku mučninu. UPALA PLUĆA (pneumonija), teška bolest pluća koja je najčešće uzrokovana bakterijom pneumokokom. Uzrok može biti i infekcija virusima ili mikoplazmom. Alveole se pune tekućinom što otežava disanje jer se bitno smanjuje respiracijska površina. UPOZORAVAJUĆA OBOJENOST (aposemija), izrazita obojenost tijela živim i upadljivim bojama kojom se predatori opominju na prisutnost otrovnih izlučevina, neugodne mirise, žalac i sl. Poznati su primjeri aposemične obojenosti kod daždevnjaka, mnogih zmija ili tvora.
O H O
Uracil

URACIL, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo RNA. UREMIJA, otrovanje organizma zbog nakupljanje ureje u tjelesnim tekućinama (krvi) jer se kod oboljelih bubrega smanjuje se mogućnost izlučivanja tog otrovnog spoja (ureje) iz krvi. URETRA, v. mokraćna cijev. URIN, v. mokraća. UROBILIN B, v. eritrociti. URTIKARIJA v. koprivnjača. USNAČE, skupina pretežno zeljastih biljaka dvosupnica. Stabljika je četverobridna. Cvijetovi su jednosimetrični, a na vjenčiću razlikujemo gornju i donju usnu (ime!). Plod je kalavac koji se raspada na četiri oraščića. Većina usnača sadrži eterična ulja i ljekovite tvari te se rabe kao začinsko i ljekovito bilje. To su npr: bosiljak, mravinac (origano), mažuran, majčina dušica, metvica, ružmarin, lavanda i ljekovita kadulja. Česte su vrste mrtve koprive. USPRAVNI ČOVJEK, v. Homo erectus. UZDUŠNICE (traheje), hitinske cjevčice kod uzdušnjaka (stonoge i kukci) za udisanje zraka i prijenos kisika neposredno u tkiva. Na površini se tijela otvaraju otvorima koje nazivamo odušak ili stigma, a u unutarnjosti se granaju u sve manje cjevčice: dušnice ili traheole. Dopiru u tkivima do samih stanica, a ulaze i u krila. UZDUŠNJACI (Tracheata), životinje iz skupine člankonožaca, isp. Prilagođeni su životu na kopnu. Dišu uzdušnicama ili trahejama, isp. Uzdušnjacima pripadaju stonoge i kukci. UZLAZNI TOK VODE U BILJCI, prolazak vode kroz kapilarni sustav stabljike

N C

C N H

C C

H H

147

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

od korijena do vrha biljke. Omogućen je pojavama osmoze i korijenovog tlaka, silama kohezije i adhezije, kapilarnosti, transpiracijom i gutacijom, isp.

V
VAGILNI ORGANIZMI, v. bentos. VALIN, kemijski spoj iz skupine aminokiselina. VANJSKO DISANJE, v. disanje. VAPNENAČKE BILJKE, v. bazofilne biljke VARIOLA, v. boginje. VAZODILATATORI, lijekovi koji šire male krvne žilice i na taj način snizuju krvni tlak VEGETACIJA, sve biljne zajednice nekog područja. Flora i vegetacija nekog područja čine njegov biljni pokrov. VEGETATIVNI ORGANI, v. stablašice. VEGETATIVNI ŽIVČANI SUSTAV, v. autonomni živčani sustav. VEGETATIVNO RAZMNOŽAVANJE, razmnožavanje kojim od dijelova vegetativnih organa (korijena, listova, stabljike) nastaju jedinke koje su genetički istovjetne s matičnom biljkom. VELIKE BOGINJE, v. boginje. VELIKI (sistemski) OPTOK KRVI, započinje s aortom. Krv se dalje potiskuje velikim a potom malim arterijama u arteriole, te dalje u arterijski i venski kraj kapilara. U području kapilara izmjenjuju se plinovi. Oksigenirana (arterijska) krv otpušta stanicama kisik, a od stanica pre-

uzima ugljikov dioksid. Otpuštanjem kisika arterijska krv se deoksigenira i postaje venska krv. Venska krv teče dalje venulama, malim i velikim venama te gornjim i donjim šupljim venama ulazi u desnu pretklijetku. Kontrakcijom desne pretklijetke krv se potiskuje u desnu klijetku, a odatle malim (plućnim) krvotokom u pluća, isp.
VELIKI MOZAK (cerebrum), zaštićen je kostima lubanje i obavijen s tri ovojnice (dura mater, pia mater i arahnoidea). Podijeljen je na dvije hemisfere: lijevu i desnu. Kora mozga se sastoji od brojnih vijuga (gyrusa) i udubina (sulcusa) a podijeljena je i na režnjeve. To su čeoni ili frontalni, tjemeni ili parijetalni, zatiljni ili okcipitalni, te sljepoočni ili temporalni režanj. Koru (cortex) velikog mozga čini siva tvar građena od živčanih stanica, a srž (medullu) velikog mozga čini bijela tvar kroz koju prolaze motorički i osjetni završeci živčanih vlakana. Siva kora velikog mozga upravlja voljnim pokretima tijela, prima, sređuje i pamti informacije, određuje svijest, ponašanje, inteligenciju i središte je više živčane (nervne) djelatnosti. VELIKI PRASAK, (engl. “big bang”), velika eksplozija kojom je vjerojatno nastao svemir. Smatra se da je to bilo prije 10 do 20 miljardi godina. VELINGER-LIČINKA, ličinka kod mekušaca. Razvija se iz trohofore. VENE, žile dovodnice, jer dovode krv u srce. Manje su elastične od arterija. Izvana su obavijene vezivnim tkivom ispod kojeg se nalazi tanki mišićni sloj ili ga uopće nema te zatim unutarnji sloj (endotel). U unutarnjosti vena se nalaze venski zalisci koji priječe vraćanje krvi u suprotnom smjeru. VENSKI ZALISCI, v. vene. VERNALIZACIJA, proces u kojem se cvjetanje stimulira izlaganjem hladnoći (u

148

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

stadiju sjemenke ili u razvijenom, olistalom stadiju).
VERTIKALNE ZONE BIOSFERE, podjela biosfere u slojeve karakteristične po svojim klimatskim i drugim uvjetima o kojima ovisi raspored biljnih i životinjskih vrsta. Najvažnije zone odnosno njihove granice dane su u tablici. Granica
Nadmorska visina, m

overa dobiva se potomstvo čiji je omjer fenotipova 1:1 umjesto 3:1 kao kod dihibridnog križanja s dominacijom gdje nema vezanih gena. (V. shemu u Dodatku 1.) VIBRIONI, v. bakterije. VINSKA MUŠICA (Drosophila melanogaster), maleni kukac dvokrilac čije ličinke u velikom broju žive svuda gdje vrije grožđe i drugo voće. Lako se uzgaja, brzo razmnožava pa je pogodna za genetička i druga biološka istraživanja. VINSKA MUŠICA, KROMOSOMSKA GARNITURA, svi kromosomi pojedine stanice vinske mušice. U tjelesnim stanicama vinske mušice nalazi se 8 kromosoma i oni predstavljaju diploidnu garnituru. Od tih 8 kromosoma 6 je autosoma, a 2 su spolna kromosoma. Ženke imaju 6 autosoma i 2 x spolna kromosoma, a mužjaci 6 autosoma, 1 x i 1 y spolni kromosom. U gametama ili spolnim stanicama nalaze se 4 kromosoma i to predstavlja haploidnu garnituru kromosoma. Ženske gamete ili jajne stanice imaju 3 autosoma i 1 x spolni kromosom, a muške gamete ili spermiji mogu imati ili 3 autosoma i 1 x spolni kromosom ili 3 autosoma i 1 y spolni kromosom. Prema tome, kod vinske mušice mužjak stvara dvije vrste spermija s različitim kromosomskim garniturama u odnosu 50 %:50 %. Ta je shema značajna jer se u istom obliku pojavljuje i kod čovjeka. VINSKI KVASAC, v. kvaščeve gljivice. VIRCHOW, R. (1821. – 1902.), njemački patolog koji je 1858. godine dao ključni prilog staničnoj teoriji tvrdnjom da sve nove stanice nastaju diobom od stanica koje su postojale (lat. Omnis cellula ex cellula.) VIRION, potpuno izgrađena infektivna virusna čestica.

Najviša točka na Zemlji Gornja granica za životinje Gornja granica za cvjetnice Gornja granica za prebivanje čovjeka Gornja granica kultura Gornja granica šuma Gornja granica šuma u Alpama Donja granica za organizme ovisne o svjetlu Donja granica biosfere

8880 7000 6000 5000 4500 4000 2200 -200 -11 000

VETERNICA, spilja u Medvednici (Zagrebačkoj gori) u kojoj su pronađeni ostaci slični krapinskom pračovjeku. VEZANI GENI, geni koji se nalaze na istom kromosomu jedan blizu drugoga, a određuju različita svojstva. Ta se njihova svojstva nasljeđuju uvijek zajedno. Iznimno, ima slučajeva kada se vezani geni ne nasljeđuju zajedno i to onda kada dođe do pojave crossing overa. Prilikom praćenja križanja, kada su geni vezani i kada nema krosingovera treba paziti na označavanje gameta. Geni za različita svojstva koja se nasljeđuju vezano, u gametama moraju biti zajedno. Na primjer ako križamo AaBb x aabb, a geni su vezani i nema crossing

149

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

VIRNJACI, beskolutićave životinje koje pripadaju koljenu plošnjaka. Od oko 3000 vrsta većina živi slobodno u moru i kopnenim vodama. Dugački su do 20 mm. Površina virnjaka je pokrivena trepetljikavim epidermom. Ispod se nalaze mišići. Tijelo je ispunjeno parenhimom koje im daje potporu i služi za spremanje rezervnih tvari, npr. glikogena. Hrane se manjim životinjama. Imaju jedan usni otvor i probavilo koje se sastoji od ždrijela i crijeva. Za izlučivanje imaju protonefridije. Živčani se sustav sastoji od glavina ganglija i živčanih vrpci. Od osjetila imaju ticala (tentakule) i jednostavne oči (ocele). Razmnožavaju se uglavnom spolno. Većina virnjaka su dvospolci ili hermafroditi. Imaju veliku moć regeneracije. v. i plošnjaci. VIROIDI, čestice manje od virusa, otkrivene sedamdesetih godina. Sastoje se samo od gole ribonukleinske kiseline, a uzrokuju bolesti samo u biljaka. VIROZE, bolesti biljaka, životinja i čovjeka uzrokovane virusima. VIRUS MOZAIČNE BOLESTI DUHANA (TMV), virus koji uzrokuje mozaičnu bolest duhana. Bolesne biljke imaju listove sa žućkastim pjegama poput mozaika i sporije rastu. VIRUSI (lat. virus – otrov), sitne čestice koje uzrokuju često opasne zaraze, jedan od najjednostavnijih oblika života. Sadrže samo jednu nukleinsku kiselinu (ili DNA ili RNA) koja je obavijena proteinskom ovojnicom (kapsidom). Svi virusi su paraziti (nametnici) jer mogu živjeti i razmnožavati se samo u živim stanicama biljaka (npr. duhana, mozaična bolest duhana), životinja i čovjeka (npr. gripa, bjesnoća, velike boginje, vodene kozice, ospice, dječja paraliza, herpes, AIDS itd.). Osim biljnih i životinjskih virusa postoji i skupina virusa koja napada bakterije, tzv bakteriofagi.

Virusi su dugi od 10 do 300 nm pa se ne mogu vidjeti svjetlosnim, već samo elektronskim mikroskopom. Ne pokazuju sve osobine žive tvari pa se ne smatraju organizmima, već ih se najčešće naziva česticama žive tvari. Neki virusi brzo mutiraju.
VIŠE BILJKE, v. stablašice. VITAMINI, organski spojevi potrebni za normalno odvijanje mnogih metaboličkih procesa u organizmu. Vitamini kao i minerali ne sadrže energetske zalihe, ali su neophodni za izgradnju i održavanje organizma. Najvažniji vitamini su: vitamin C, B1, B2, A i D. VOĆNI ŠEĆER, v. fruktoza. VODA, najvažnija anorganska tvar u živim stanicama. Ona je polarna molekula i zbog toga je dobro otapalo za veliki broj anorganskih, ali i organskih tvari. Od svih kemijskih spojeva voda ima najveći udio u masi živih bića i njihovih stanica. Tako je, npr. maseni udio vode u protoplazmi stanice 70 do 85 %. Gubitak vode uzrokuje različite poremećaje u živim organizmima, npr. gubitak 15 do 20 % vode tijekom gladovanja u sisavaca uzrokuje fiziološke promjene, a na kraju i smrt. Mnoge tvari unutar organizma prenose se uz pomoć vode, kao vodene otopine. Voda je važna pri sintezi mnogih spojeva u organizmu, npr. u procesu fotosinteze sudjeluje kao jedna od sirovina. Vodene otopine podmazuju zglobove pa možemo reći da voda sudjeluje u omogućavanju kretanja mnogih organizama. Mnogi organizmi koriste vodu kao medij kroz koji muške spolne stanice putuju do ženskih omogućujući na taj način oplodnju. Voda je i neizostavan sudionik regulacije tjelesne temperature itd. VODENJACI, v. repaši. VODIKOVA VEZA, vrsta kemijske veze elektrostatičke prirode. Javlja se među pol-

150

isp. Ima pokrovnu i zaštitnu ulogu te sudjeluje u disanju. (1848. VRUĆICA.-1935. Služi za pokretanje. Uho počinje bubnjićem na površini tijela. Arterijska i venska krv se djelomično miješaju u klijetki. Za izlučivanje služi drugi bubreg. stanje povišene tjelesne temperature uzrokovano pireticima. dio je pokretačkog živčanog sustava. skupina meristemskih stanica smještenih u vršnim dijelovima korijena stabljike koje se kontinuirano dijele i pomoću kojih biljka raste u visinu (primarni rast). osnovna sistematska kategorija filogenetskog sustava (isp. Oko zaštićuju kapci i suzne žlijezde. međusobno su povezane molekule vode kao i odgovarajuće (komplementarne) duščine baze u molekuli DNA. Vodozemci su hladnokrvne životinje i ne mogu živjeti na niskim temperaturama. Za pojačanje glasa mužjaci nekih vrsta žaba imaju zvučne mjehure. Za kretanje po tlu i plivanje služe se razvijenim prednjim i stražnjim udovima. u grkljanu. za izmjenu plinova i za izlučivanje. VODOŽILNI (ambulakralni) SUSTAV. proučavao genetiku i promicao Mendelove zakone nasljeđivanja. Oni se hrane algama i postupno se preobražavaju u odrasle. Zimi zapadaju u "zimski san". Na dnu su usne šupljine. Kontrolira mišiće koji rade našom voljom. Rebra su jako smanjena ili ih uopće nemaju. Iz oplođenih jaja se razviju u vodi ličinke punoglavci. Mogu prilagođavati oči blizom i dalekom gledanju. nizozemski botaničar. glasne žice. Kralježnica je sastavljena od 9 kralježaka. VRSTA. Vrstu čine: jedinka. Dem je skupina genetički sličnih. Populaciju čini više dema među kojima još postoji mogućnost genske izmjene. repaši (daždevnjaci. De VRIES H. prvi kralježnjaci koji su se djelomično prilagodili životu na kopnu. Prvi. Srce je trodjelno: sastoji se od 2 pretklijetke i 1 klijetke. v. U unutarnjem uhu nalazi se labirintni organ. Odrasli vodozemci dišu plućima i preko vlažne kože. Njihovim se titranjem proizvode glasovi. cenobije. Iz pet zrakasto postavljenih cjevčica izlaze prionljive ili ambulakralne nožice. Vodikovim vezama npr. VODOZEMCI (Amphibia).) koja se sastoji od biljnih i životinjskih jedinki slične građe i načina života koje se mogu međusobno rasplođivati. na koji se vežu kosti lubanje zove se nosilac ili atlas. Mokraću i spolne stanice izvode prvo u nečisnicu.). jednostanična zelena alga s bičevima udružena u velike kuglaste nakupine. bogata žlijezdama i vlažna. VRENJE. vremenski i prostorno blisko povezanih jedinki. hranjenje. Vodozemci imaju sposobnost regeneracije. Za razliku od kolonija u cenobiju vlada podjela rada: neke stanice su zadužene za kretanje. kod bodljikaša sustav prstenasto i zrakasto raspoređenih cjevčica kroz koje struji morska voda. VRŠNI (apikalni) MERISTEMI. Srednje uho je Eustahijevom cijevi povezano s usnom šupljinom. fermentacija. kao osjetilo. Koža je višeslojna. kao npr. Oplodnje je vanjska. Dobro je razvijen koštano . bezrepci.mišićni sustav. vodenjaci i čovječja ribica) i bezrepci (žabe). gdje se pozitivan kraj jedne molekule okreće prema negativnom kraju druge molekule. Danas živi oko 2500 vrsta podijeljenih u 3 skupine: beznošci (rijači). VOLVOKS (Volvox). Uništava- 151 . Žive u vlažnim staništima. Većina vrsta se razmnožava u vodi ili vlažnim kopnenim staništima.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE arnim molekulama. neke preuzimaju prehrambenu ulogu a neke ulogu u razmnožavanju. VOLJNI ŽIVČANI SUSTAV. dem i populacija. stanje mirovanja.

WHITTAKER. povratka krvi iz klijetke u pretklijetku. Uzrokuju bolove u mišićima. osim temeljnih (Zakon o zaštiti okoliša i Zakon o zaštiti prirode). bez mogućnosti 152 . J.. M. 1928. C.H. Oko njih se stvara čahura od vezivnog tkiva. god.. vodama. predložio je razdiobu živog svijeta u pet carstva. Čovjek se zarazi ako jede zaraženu svinjetinu. R. krypto = skriven). znameniti graditelj optičkih instrumenata. ZELENA PUPAVKA. W WATSON. kao npr. embrij. ZAŠTITNA OBOJENOST (kriptična obojenost. ZELENE ALGE. Brzo se razmnožavaju. ZAVOJITA TRIHINA. v. šumama. Oni osiguravaju jednosmjeran protok krvi iz pretklijetke u klijetku. skup aktivnosti kojima se nastoji smanjiti štetno djelovanje čovjeka na živi i neživi okoliš. što sužava otvor (stenoza) i otežava protok krvi. A. bijela boja polarnih životinja. a mlade trihine koje se izlegu u limfnim žilama čovjeka. ZALISCI SRČANI (valvule). v. ZAKRŽLJALI ORGANI.. zaštiti bilja i zraka. člankom. Osnivanjem različitih kategorija zaštite prirode pokušavaju se očuvati određena biogeografska područja.. opasan nametnik iz skupine oblića.F. grč. rudimenti. WOHLER. v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ njem uzročnika bolesti i uzimanjem antipirogenih lijekova (antipiretici) moguće je tjelesnu temperaturu vratiti u normalu. američki znanstvenik koji je s austrijskim znanstvenikom Landsteinerom otkrio Rhesus faktor. (kategorije zaštite prirodne baštine Hrvatske).). 1969. embrioblast. Druga mogućnost su promjene u građi zalistaka što sprečava potpuno zatvaranje zalistaka. Ustava Također su donešeni. WIENER. (rođ. jednostanični i višestanični zeleni organizmi čija boja potječe od Z ZAKONI NASLJEĐIVANJA. američki biolog koji je zajedno s britanskim fizičarom F: Crickom 1953. kada nastaje zadebljanje zalistaka. F. godine iznio model molekule DNA. britanski biokemičar koji je svojim istraživanjima strukture molekule DNA potvrdio vrijednost modela molekule DNA kojeg su predložili Watson i Crick. Trihine se u organizam unose u obliku čahura. Mendelovi zakoni. njemački tvorničar. dodatak 4. Zalisci mogu biti oštećeni i to najčešće zbog upale. Ta prilagodba ima važnu ulogu pri prirodnom odabiru. stapčarke. njemački kemičar koji je 1828. zakoni o npr. ZAMETNI LISTIĆ. v. ZEISS. Time je dokazao mogućnost sinteze organskih spojeva bez djelovanja živih bića.. god. kemijskim putem sintetizirao ureu. WILKINS. Zaštita prirode u Hrvatskoj utemeljena je 69. v. nalaze se u otvoru između svake pretklijetke i klijetke. v.. povišenu temperaturu i dr. naseljuju se u mišićima. obojenost tijela ili dijelova tijela kojom organizmi oponašaju svoj okoliš te ih čini manje uočljivim njihovim neprijateljima. ZAMETAK. ZAŠTITA OKOLIŠA.H.

Na pr. Zigota se dijeli mitotičkim diobama te se tako iz nje razvija novi organizam. haploidan broj kromosoma (n) od oca i haploidan broj kromosoma (n) od majke. uz prethodnu redukcijsku diobu. bjelouška. od neotrovnih zmija npr. mokraćne kiseline. ZIGOTA. Tako se čuva energija jer se metabolizam jako uspori. a gametofit haploidna. Te su žlijezde preobražene žlijezde slinovnice. ZOOCENOLOGIJA. Umjesto organa za sluh imaju osjetljiv rašljasti jezik koji služi i za opip i njuh. fizika i kemija. Zmije nemaju pokretne očne kapke već im je oko pokriveno prozirnom opnom. ali vibracije osjete preko kostiju lubanje. a svaka se strana donje čeljusti može pomicati neovisno dok gutaju plijen. znanost o zoocenozama. Imaju kvadratnu kost. bjeloočnica. Sporofit je uvijek diploidna generacija.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE a i b klorofila. sveukupno. isto što i žlijezde znojnice. 153 . amonijaka i hlapljivih masnih kiselina. Zmije otrovnice imaju žljebaste ili šuplje zube koji su povezani s parom otrovnih žlijezda. Koža im je pokrivena rožnatim ljuskama. materijal i metode rada. mješinarke i penicilijum. U čeljustima imaju zube. ZMIJE. tekućina po kemijskom sastavu slična mokraći. uvod. v. v. ZEMLJINA PRAATMOSFERA. sporofit. rezultate. a iz spore se razvije spolna generacija. Stanična stijenka je od celuloze. Mnogi vodozemci i gušteri nepovoljne zimske uvjete preživljavaju zakopani u mulju ili u tlu. spirogira (Spirogyra). ZNANSTVENI RAD. oplođena jajna stanica koja nastaje stapanjem različitih spolnih stanica (gameta). Predstavnici su kišna alga (Pleurococcus). spolno gametama koje proizvodi spolna generacija ili gametofit te nespolno sporama koje se razvijaju na sporofitu. Iz zigote gametofita razvija se nespolna generacija. ZJENICA (pupilla). Hrane se isključivo drugim životinjama. ZNOJNE ŽLIJEZDE. a od otrovnica poskok i riđovka. glodavci i neki medvjedi. Razlikujemo prirodne i društvene znanosti. isp. od sisavaca: kukcojedi. ZIMSKI SAN (hibernacija). raspravu. otopljena NaCl. morska salata (Ulva lactuca) itd. matematika. šišmiši. klamidomonas (Chlamydomonas). ZNOJ. Sastoji se od 95 do 98 posto vode. do točke smrzavanja organizma. tekst u kojem znanstvenik iznosi u javnost način rada i rezultate svojih istraživanja. zaključak. Produkt fotosinteze je škrob. Razmnožavaju se vegetativno (mitotičkom diobom). mokraćevine. gametofit. povezano organizirano i sistematizirano ljudsko znanje. sažetak. volvoks (Volvox). ljuskaši iz skupine gmazova. ime autora. v. Ishlapljivanje znoja ima važnu ulogu u termoregulaciji i regulaciji sastava tjelesnih tekućina. ZNANOST. Sadrži diploidan broj kromosoma (2n). tj. zahvalu i popis literature. zimsko mirovanje životinja nalik na san. Spolno i nespolno razmnožavanje pravilno se izmjenjuju i nadopunjuju. Znanstveni rad iz područja biologije obično sadrži naslov rada. ZELENE PLIJESNI. U našim krajevima česte su. Taj proces se zove i antitetska izmjena generacija. Nemaju ni bubnjić. U prirodne znanosti ubrajaju se biologija. praatmosfera. To je bit izmjene generacija. Nemaju noge već se pokreću svijanjem trupa i repa koji zajedno imaju 200 i više kralješaka. crvenkrpica i kravosas. Za to vrijeme životinje se ne hrane a štitna žlijezda održava tjelesnu toplinu i 20 0C nižu od normalne.

v. mejoza. Ž ŽABE. prirodna životna zajednica životinja u nekoj biocenozi. 154 . Utjecaj zračenja na neki organizam ovisi. simetrija kod koje su organi smješteni zrakasto oko središnje osi. ZRAČENJE.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ZOOCENOZA (grč. mezogleja i gastroderm ili endoderm. vuk. šumske biljke (bijela šumarica. Kada se žarnica podraži. Najgušće su poredane na lovkama. ZRAKAŠI. ŽARNE STANICE (knidociti). v. isp. korjenonošci. Pojavljuju se u dva oblika tijela . ZOOLOGIJA. Sistematski se dijele na tri skupine: obrubnjaci. zlatica). Polipi žarnjaka imaju veliku moć regeneracije. Mnogi žarnjaci. Oplodnja je vanjska. U dvospolnom se cvijetu nalaze zavojito poredani veći broj prašnika i plodnih listova. bezrepci. Nove se žarnice mogu obnoviti za 48 sati. v. posebno zadružni. vidra i dr. ne samo o samom organizmu. plankton. gama i neutronsko zračenje) čije posljedice mogu biti vidljive odmah nakon ozračivanja ili se mogu ispoljiti u potomstvu (mogu izazvati mutacije). Jedini drvenasti žabnjak je pavitina. ŽARNJACI (Cnidaria). Tijelo izgrađuju tri sloja: epiderm ili ektoderm. metageneza. Živčani sustav je mrežast. ZORIDBENA DIOBA. jedna od najprimitivnijih skupina dvosupnica. Žabnjacima pripadaju mnoge livadne biljke (žabnjak ljutić. izgrađuju unutarnje i vanjske kosture. Ovu životinjsku komponentu biocenoze proučava znanost zoocenologija. Mnogi žarnjaci imaju izmjenu nespolne i spolne generacija. ris. probavni enzim iz želučanog soka koji sudjeluje u razgradnji masti.polip i meduza. Kod nas su poznate zvijeri: medvjed. Radijalno simetrične životinje su sjedilački (sesilni) ili slabo pokretni organizmi. beta. ubijanje i komadanje plijena. Njima love hranu. Zeljaste su biljke. ZOOFAGI. kuna. U epidermu se nalaze i žarne stanice. Plod je orah ili mjehur. Iz oplođenog jajeta razvija se trepetljikava ličinka planula. znanost koja proučava životinje. lasica. a porodica hidri u slatkoj vodi. već i o vrsti i količini zračenja. v. emitiranje različitih vrsta zraka od kojih neke mogu štetno djelovati na organizme. Listovi su najčešće razdijeljeni. U svakoj se stanici nalazi žarnica ili knida. Grabežljivci su i zubi su im prilagođeni za hvatanje. koralji i režnjaci. izbaci se cjevčica kroz koju istječe otrov. lisica. Razmnožavaju se nespolno pupanjem (polipi) i spolno. drugo ime za mesojede. Žive pretežno u moru. ZRAKASTA (radijalna) SIMETRIJA. crni kukurijek) te močvarne biljke (kaljužnica). Nemaju organe za disanje i izlučivanje. zrakasto simetrični bezkralježnjaci. ŽELUČANA LIPAZA. koine = zajednica). ZOOPLANKTON. skupina sisavaca koja se hrani mesom. bez crijevnog otvora. ZVIJERI. ŽABNJACI. žarnjaci ili bodljikaši. Usta su okružena lovkama i nastavljaju se u probavnu (gastrovaskularnu) šupljinu. To je stanični organel koji sadrži otrov i jednu smotanu cjevčicu. kao npr. zoon = životinja. posebni oblici stanica kod žarnjaka. Ako se spolno razmnožavaju spolovi su razdvojeni. Tako je za zdravlje čovjeka posebno opasno radioaktivno zračenje (alfa.

U šupljinu glavice ulazi potporni štapić koji se može smatrati začetkom svitka. Nazivaju se i polusvitkovci. Na ždrijelu imaju niz škržnih pukotina. Probavni želučani sokovi sastoje se od probavnih enzima (pepsin) i kloridne kiseline (HCl). Bogata je krvnim kapilarama koje oku dopremaju kisik i hranidbene tvari. Optjecajni sustav je otvoren. razmnožavaju se i umiru. ŽIROGLAVCI. tijela želuca (fornix. ŽIVČANA STANICA (neuron). akson (neurit). ŽELUDAC. nalaze se u stijenci želuca. maternicu i rodnicu i vanjske organe: stidnicu i dražicu (klitoris).5. 155 . što također pokazuje sličnost sa svitkovcima. razlikujemo unutarnje organe: jajnike. Građena je od tijela stanice (soma) iz kojega izlazi veći broj kratkih živčanih vlakana (dendrita) i jedno duže živčano vlakno. Tijelo živčane stanice sadrži većinom iste organele kao i ostale tjelesne stanice osim centrosoma. hrane se. motoričkih ili mješovitih živaca. Snopovi aksona čine živčane putove u mozgu i leđnoj moždini. ali i dišu jer je ždrijelo dobro prokrvljeno. dišu. otpušta u dvanaesnik.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE ŽELUČANE ŽLIJEZDE. Zbog prisutnosti razrijeđene HCl u želucu je pH oko 1. senzorične). Žiroglavci imaju i leđnu živčanu vrpcu koja se može smatrati početkom razvoja leđne moždine kod svitkovaca. Neurone možemo podijeliti na osjetilne (receptorne. Žiroglavci su razdvojena spola. a na periferiji živce. nakon čega se hrana. Razlikuju se od nežive prirode po sljedećim obilježjima: imaju staničnu građu. ŽIVA BIĆA. ŽIVAC. Pokretni su i bilateralno simetrični oblici. rastu. kardije (cardia). ŽENSKI SPOLNI ORGANI. srednji sloj tkiva očne jabučice. pilorusa koji se veže na dvanaesnik. Pri prolasku živčanog podražaja mijenja se propusnost membrane živčanih stanica za ione natrija što uzrokuje promjenu membranskog potencijala stanice. volumena oko 1200 do 1500 ml. izmjenjuju tvari s okolišem. Ima osjetilnih. Iz oplođenog jaja nastaje ličinka tornarija koja se razvija u odrasli oblik. Tijelo je oblo. duodenum. prošireni je dio probavne cijevi u čovjeka. Sastoji se od ulaznog dijela jednjaka u želudac. corpus. zbog čega se ne mogu dijeliti. One luče na dan oko 2000 mL probavnih sokova i sluzi (mukoza). jajovode. morske životinje koje pripadaju malokolutićavcima.sinapsa. U stijenci se nalaze želučane žlijezde. biljni i životinjski organizmi i čovjek. Na okončinama aksona nalaze se završne nožice pomoću kojih se ostvaruje sveza . Filtrirajući vodu sakupljaju hranu. Neurit je obavijen mijelinskom ovojnicom. rilo). ogrlicu na kojoj su usta (sa donje strane) i dugačak trup. prijenosne i pokretačke (motorične). neurita) obavijeni ovojnicom. crvoliko i podijeljeno na tri dijela: glavicu (prosomu. osjetljivi su na podražaj. Na izlazu iz želuca nalazi se prstenasti mišić . ŽILNICA (chorioidea). ŽIVČANI PODRAŽAJ. Smatra se da je iz sličnih oblika u davnoj prošlosti poteklo razvojno stablo svitkovaca. Za izlučivanje imaju dva para nefridija. snopovi živčanih vlakana (aksona.pilorični sfinkter koji zadržava hranu u želucu dok se dovoljno ne probavi. neurohormona (neurotransmitera). fundus) i izlaznog dijela. osnovna građevna i funkcionalna jedinica živčanog sustava koja ima svojstvo primanja i provedbe podražaja. podražaj koji nastaje i prenosi se u živčanom sustavu između živčanih stanica i to kemijskim putem pomoću posebnih kemijskih tvari. sada pod nazivom himus.

Važne su za regulaciju sastava tjelesnih tekućina i termoregulaciju. smještaju i ulozi koju obavlja. primitivna golosjemenjača koja je po nekim obilježjima srodna papratnjačama. Iako nema posve oštrih granica među pojedinim skupinama živih bića ipak ih možemo podijeliti prije svega na nadcarstva prokariote. Taj enzim već u ustima razgrađuje škrob u maltozu i glukozu. Životne se zajednice sastoje od biljaka (fitocenoza). riba latimerija (iz Indijskog oceana) preostala je od davno izumrle skupine resoperki ili kinesko drvo ginko.6 do 7. U 156 .). Nastaje akcijski potencijal mišićnog vlakna i povećava se koncentracija iona kalcija u vlaknu. odnosno skupina jedinki različitih populacija koje žive na određenom staništu. ŽIVOTINJSKA STANICA. ŽIVČANO-MIŠIĆNA VEZA (motorička pločica. Izlučuju na dan 1 do 1. sinapsa). koja su građena od niti miozina i aktina. podvilične (submandibularne) i podjezične (sublingvalne) i imaju svoje izvodne kanale u usnu šupljinu. U prokariote spada carstvo monere. pH vrijednosti 5. ŽLIJEZDE S UNUTARNJIM IZLUČIVANJEM. grč.6. prenosi. zajednica raznovrsnih biljnih i životinjskih organizama na određenom staništu. obrađuje. koji ulazi u sinaptičku pukotinu i omogućuje prijenos podražaja na mišić. ŽLIJEZDE ZNOJNICE. ŽIVI FOSILI. voljni i autonomni. te reagira na primljene podražaje ili obavlja misaonu radnju. sustav koji s milijardama živčanih stanica (neurona) prima. žlijezde koje luče slinu. živčani sustav možemo podijeliti na osjetilni i pokretački. ŽIVI SVIJET. miofibrile. pohranjuje i očitava brojne informacije iz tijela i okoline. Zajedno s endokrinim (hormonalnim) sustavom upravlja životnim funkcijama. biljke i životinje.5 sline. koja je potrebna za klizanje aktina i miozina jednih među druge odnosno kontrakciju mišićnih vlakana. stanica. Lučenje je sline refleksna reakcija. u kojoj se nalazi probavni enzim ptijalin (alfa amilaza). endokrine žlijezde. postoje šumske. Funkcionalno ima dva osnovna dijela: tjelesni (somatski) i vegetativni (autonomni). virusi. ŽIVOTNA ZAJEDNICA (biocenoza. biljni i životinjski organizmi koji su živjeli u davnoj prošlosti. ŽLIJEZDE SLINOVNICE. jezerske i druge biocenoze. v. Prema građi. koine = zajednica).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ŽIVČANI SUSTAV. Kod čovjeka postoje tri para: podušne (parotidne). To potiče oslobađanje energije iz ATP-a. Živčani podražaj uzrokuje oslobađanje prijenosne tvari acetil-kolina. v. gljive. v. eukariote i posebno izdvojene viruse. mjesto prijenosa živčanog podražaja (impulsa) sa živca na mišićno vlakno. močvarne. posebno u hranidbenim lancima. životinja (zoocenoza) i mikroorganizama (mikrobiocenoza). nalaze se usmini kože. Tako npr. Dijele se na jednostanične i mnogostanične. heterotrofni eukarioti. a u eukariote protisti. čine živa bića (isp. Biljke Gljive Protisti Monere Životinje Eukarioti Prokarioti Shema podjele živih bića ŽIVOTINJE. Vlakno sadrži brojna mišićna vlakanca. bios = život. a održali su se do danas. Npr. ŽIVOTINJSKI VIRUSI. livadne. a usko su povezane različitim međuodnosima. središnji i periferni.

a najviše na čelu. mlječika itd. Tu su još žljezdane dlake koje proizvode različite hlapljive i mirisne tvari. na dlanovima i tabanima. Izlučuju znoj. ŽUČ. infekcija mjehura i žučovoda. ŽUTICA NOVOROĐENČETA. Četinjače. koje s vremenom postaju sve veće. Ako kamenac zapne u žučovodu. spriječit će se protok žuči u crijevo. pod pazuhom. žučnu boju bilirubin (produkt raspalog hemoglobina iz mrtvih eritrocita). npr. u svim svojim dijelovima sadrže smolenice. kadulja. Kod potpunog začepljenja žučovoda nastaje žutica. Mliječne cijevi s mliječnim sokom svojstvene su biljkama iz porodica makova. fetalna eritroblastoza. porodica usnača (majčina dušica. Liječi se odstranjenjem žučnog mjehura s kamencima (kolecistektomija). Luteinske stanice izlučuju hormone estrogene i progesteron. pohranjuje i koncentrira žuč nastalu u jetri. ŽUČNI KAMENCI. lecitin te različite elektrolite. osim porodice tise. v. a javljaju se grčevi i jaka bol (žučne kolike). Zajednički izvodni kanal žučovoda (ductus choledocus) ulijeva žuč u dvanaesnik. 157 . ŽUTO TIJELO (corpus luteum).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tijelu ih ima oko 2 do 3 milijuna. ŽLJEZDANO (ekskrecijsko) STANIČJE. tvorba koja nastaje u jajniku sisavaca iz Graafovog mjehurića nakon ovulacije. služi proizvodnji i izlučivanju određenih vrsta tvari u biljaka. kolesterol. tvorba kruškolikog oblika smještena na donjoj strani jetre. prestaje izlučivati hormone. iz svojih stanica gubi masti i postaje bijelo tijelo (corpus albicans). Nektariji su žljezde koje luče slatki (“cvjetni”) sok nektar koji primamljuje kukce oprašivače. nosu. Eterična ulja u štitarki proizvode proizvode se u posebnim stanicama i izlijevaju u uljne kanale. Tijekom trudnoće žuto tijelo izlučuje povećane količine estrogena i progesterona koji sprječavaju pojavu menstruacije i time gubitak ploda. Kapacitet žučnog mjehura je oko 500 mL žuči na dan. Žuč je složena otopina koja sadržava soli žučnih kiselina za emulgiranje (raspršivanje) masti. ŽUČNI MJEHUR. isp. stvara se u stanicama jetre. stvaraju se u žučnom mjehuru u početku kao male krute čestice. Može nastati upala. smolne kanale s bogatim sadržajem hlapljivih smola. Jako se međusobno razlikuju u svim elementima ovisno o bljnoj vrsti. Uzrok nastanku žučnih kamenaca nije poznat. bosiljak i druge). Ako nije došlo do oplodnje žuto tijelo se smanjuje. Sastoji se od luteinskih stanica koje sadrže masti i koje su žute jer sadrže žutu boju lutein po čemu je čitava tvorba i dobila ime.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ 158 .

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PITANJA 159 .

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ 160 .

_________________________________________________________________________ Pitanja Pitanja s jednim točnim odgovorom 1. Razasuti u citoplazmi ili vezani uz opne endoplazmatske mrežice su: A) lizosomi B) mitohondriji C) kloroplasti D) grana E) ribosomi 5. Kromatin je sastavni dio: A) jezgre B) ribosoma C) endoplazmatske mrežice D) centriola E) lizosoma 10. Aktivni prijenos kroz staničnu membranu ovisi o: A) veličini čestica koje se prenose B) koncentracijama otopina s jedne i s druge strane membrane C) veličini pora u membrani D) svojstvima otapala E) raspoloživom ATP 9. Kretanje molekule otopljene tvari iz područja veće u područje manje koncentracije dviju otopina odvojenih opnom zove se: A) difuzija B) dijaliza C) osmoza D) fagocitoza E) Brownovo gibanje 11. Srednji zametni listić se zove: A) ektoderm B) endoderm C) mezoderm D) blastoderm E) blastocista 3. Raspored kromosoma i gena u gametama ovisi o: A) prvoj mejotičkoj diobi B) drugoj mejotičkoj diobi C) metafazi mitoze D) u jednakoj mjeri o obje mejotičke diobe E) o rasporedu kromosoma koji se uspostavi već u zigoti 4. Tilakoide nalazimo u: A) mitohondrijima B) ribosomima C) Golgijevom tijelu D) kloroplastima E) kromosomima 6. Nakupine hidrolitičkih fermenata nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima 161 . Jezgru nemaju: A) spermiji B) jajašca C) spolne prastanice D) jednostanične alge E) modrozelene alge 7. Trofoblast nalazimo u embrionalnom razvitku: A) ježinaca B) žabe C) daždevnjaka D) kukaca E) čovjeka 2. Mitoza je važna jer se za njenog trajanja: A) udvostručuju DNK B) udvostručuju kromosomi C) odvajaju kromatide istog kromosoma D) sparuju homologni kromosomi E) vrši redukcija broja kromosoma 8.

Proces u kojem se formiraju zametni listići zove se: A) brazdanje B) gastrulacija C) sporulacija D) partenogeneza E) metamorfoza 162 .ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 12. Oba roditelja (zamorci) s crnim krznom daju potomke i s crnim i s bijelim krznom. Sastavni dio enzima je uvijek: A) neki metal B) oligosaharid C) jedan ili više polipeptida D) jedan ili više polinukleotida E) oligonukleotid 20. Dušične baze nalaze se u: A) polisaharidima B) trigliceridima C) polipeptidima D) polinukleotidima E) aminokiselinama 23. Kojih su genotipova roditelji ili o kakvom se križanju radi: A) Aa x AA B) AA x AA C) Aa x Aa D) intermedijarno križanje E) test križanje 14. Izvor vodikovih iona u fotosintezi je: A) klorofil B) NADPH2 C) atmosferski vodik D) voda E) glukoza 22. RNK su nasljedna tvar: A) bičaša B) bakterija C) modrozelenih alga D) bakterijskih virusa E) biljnih virusa 19. Glikoliza se odvija u: A) hrapavoj endoplazmatskoj mrežici B) glatkoj endoplazmatskoj mrežici C) Golgijevom tijelu D) citoplazmatskom matriksu E) mitohondriju 17. Disaharid je: A) škrob B) riboza C) saharoza D) fruktoza E) galaktoza 16. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2 D) fermentacija E) Krebsov ciklus 15. Oksidacija je proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitaka elektrona D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima 18. ATP je spoj skupine: A) aminokiselina B) monosaharida C) oligosaharida D) steroida E) nukleotida 21. Kromosomi se udvostručuju u: A) profazi B) metafazi C) anafazi D) telofzi E) ni u jednoj navedenoj fazi 13.

Izlučivanje oksitocina za vrijeme dojenja uvjetuje: A) mliječna žlijezda B) neurohipofiza C) adenohipofiza D) hipotalamus E) jajnik 32. Jajna stanica sazrijeva u: A) Graafovom folikulu B) jajovodu C) maternici D) sjemeniku E) žutom tijelu 26. Koliko dušičnih baza određuje ugradnja jedne aminokiseline pri sintezi bjelančevina? A) 1 B) 3 C) 6 D) 9 E) 16 34. Trojku ili kodon čine tri: A) dušične baze B) deoksiribonukleinska kiselina C) aminokiseline D) molekule ATP E) hormona hipofize 33. 4 fenotipa omjera 25%:25%:25%:25% nastaju križanjem: A) dvaju različitih homozigota B) dvaju različitih heterozigota C) dvaju jednakih heterozigoa D) jednog heterozigota s recesivnim homozigotom E) jednog heterozigota s dominantnim homozigotom 35. Hipotalamus: A) sintetizira gonadotropne hormone B) izlučuje gonadotropne hormone C) kontrolira sintezu gonadotropnih hormona D) sintetizira prolaktin E) izlučuje tiroksin 27. Prolaktin izlučuje: A) hipotalamus B) mliječna žlijezda C) jajnik D) adenohipofiza E) neurohipofiza 30. Zakone nasljeđivanja formulirao je: A) Darwin 163 ._________________________________________________________________________ Pitanja 24. Stalnu funkciju sjemenika regulira i održava: A) hipotalamus B) prostata C) muški spolni hormon kore nadbubrežne žlijezde D) timus E) neurohipofiza 31. Bijelo tijelo (korpus albikans) susreće se u: A) u svakoj stanici viših biljaka B) u spolnim stanicama životinja C) sjemeniku D) jajniku E) prostati 28. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje 25. Za vrijeme trudnoće: A) luči se više estrogena od progesterona B) luči se više progesterona od estrogena C) prestaje sinteza progesterona D) prestaje sinteza estrogena E)adenohipofiza počne izlučivati oksitocin 29.

Suvremenom shvaćanju evolucije ne pripada činilac: A) genska snaga B) izolacija C) svrsishodnost D) divergencija E) prirodna selekcija 44. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300m D) 400m E) 450 m 46. Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi B) fitofagi C) zoofagi D) heterofagi E) autotrofi 42. Prostor na kojem je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem 41. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopadno drveće C) travnjaci D) papratnjače E) mahovine i lišaji 38. dok je manje razvijena u biljnih stanica 45. Svi ekosustavi zajedno čine: A) biotop B) biosferu C) populaciju D) biocenozu E) ionosferu 39. U Mendelovim križanjima graška duge i kratke stabljike djelovanje recesivnog činioca izrazilo se u F2 generaciji u: A) 50% potomaka B) 25% potomaka C) 75% potomaka D) 10% potomaka E) 0% potomaka 37. Omjer fenotipova 9:3:3:1 dobije se samo ako su genotipovi dvaju roditelja: A) AAbb i AAbb B) aaBB i aaBb 164 . Važni razlagači u ekosustavima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 40. Endoplazmatska mrežica: A) dobro je razvijena u embrionalnim stanicama B) dobro je razvijena u stanicama gušterače C) slabo je razvijena u stanicama gušterače D) dobro je razvijena u stanicama tumora E) u jednakoj je mjeri razvijena u svim tipovima životinjskih stanica. Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) mesojeda 43.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) Mendel C) Mendelejev D) Morgan E) Lamarck 36.

_________________________________________________________________________ Pitanja C) AaBb i AaBb D) AaBb i aabb E) AAbb i aaBB 47. Križanjem ružičaste i crvene zijevalice nastaju: A) sve ružičaste zijevalice B) sve crvene zijevalice C) 50% bijelih i 50% crvenih zijevalica D) 25% crvenih i 75% ružičastih zijevalica E) 50% crvenih i 50% ružičastih zijevalica 51. Koji će od navedenih genotipova dati fenotip koji se razlikuje od ostala 4 fenotipa: A) AABB B) AaBB C) AaBb D) AABb E) AAbb 48. Što se ne odnosi na oksitocin: A) hormon koji izlučuje adenohipofiza B) hormon koji izlučuje neurohipofiza C) potiče sekreciju mlijeka nakon poroda D) dospijeva krvlju do maternice E) izaziva kontrakciju mišića maternice 54. Za pripadnike krvne grupe A karakteristično je da na membranama svojih eritrocita imaju: A) aglutinogen A B) aglutinogen B C) aglutinogen A i aglutinogen B D) anti A aglutinin E) anti A i anti B aglutinin 50. Jednostruku membranu imaju: A) jezgra B) ribosomi C) mitohondriji D) centrosom E) lizosomi 58. Grašak genotipa AABb može proizvoditi gamete s genima: A) A B) B C) b D) Bb E) AB 57. Točan rezultat fotosinteze je: A) C6H10O5 + 6O2 + 6H2O B) C6H12O6 + 12O2 + 6H2O C) C6H12O6 + 6O2 + 12H2O D) C6H12O6 + 6O2 + 6H2O E) C6H12O6 + 10O2 + 6H2O 53. Heterozigoti su zijevalice: A) samo bijele B) samo crvene C) samo ružičaste D) crvene i bijele E) crvene i ružičaste 49. Najpovoljniji pH za većinu enzima (fermenata) kreće se oko: A) 3 B) 5 C) 7 D) 9 E) 11 52. Prvi sisavci javljaju se u: A) permu B) trijasu C) srednjem mezozoiku D) tercijaru E) kvartaru 56. Konjugacija kromosoma događa se u: A) profazi mitoze B) metafazi mitoze C) profazi I mejotičke diobe D) profazi II mejotičke diobe E) metafazi II mejotičke diobe 55. Citologija je znanost o: A) strukturi stanice 165 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) molekulskoj građi stanice C) biokemijskoj građi jezgre D) biokemijskoj građi i funkciji stanice E) tri su odgvora točna 59. Koji su parovi komplementarnih baza u DNK? A) adenin-uracil B) adenin-gvanin C) citozin-timin D) citozin-gvanin E) citozin-uracil 62. U kojem križanju dolazi do izražaja princip slobodne kombinacije? A) monohibridnom s dominacijom B) monohibridnom intermedijarnom C) dihibridnom s dominacijom D) u svim tipovima križanja E) u križanjima s diploidnim organizmima 166 . riboza i trifosfat C) adenin. riboza i difosfat D) adenin. Najveće količine energije u stanici veže molekula ovog sastava: A) adenozin. Molekula klorofila može reagirati na svjetlosnu energiju Sunca ako je u: A) oksidiranom stanju B) reduciranom stanju C) blizini molekule glukoze D) blizini molekule glikogena E) blizini molekule škroba 64. Što ukazuje na početak gastrulacije u žaba: A) formiranje zametnih listića B) pojava blastoporusa C) povećanje blastule D) nestanak blastocela E) pojava arhenterona 68. Za razvitak živčanog sustava potreban je kontakt: A) mezoderma s ektodermom B) endoderma s ektodermom C) endoderma s mezodermom D) svih triju zametnih listića E) trofoblasta s embrioblastom 69. riboza i fosfat E) adenozin i trifosfat 63. Pasivni transport ne može biti: A) preko proteinskih prenosilca B) u smjeru pada koncentracije C) preko kanalnih proteina D) od manje koncentracije prema većoj E) olakšana difuzija 61. Citoplazmatske organele obavijene membranom imaju: A) samo biljne stanice B) samo životinjske stanice C) bakterije D) modrozelene alge E) eukariotske stanice 66. Estrogen i progesteron su hormoni: A) hipofize B) gonadotropni hormoni C) intersticijskih stanica D) žutog tijela E) bijelog tijela 65. Vezivanjem jedne molekule glukoze i jedne molekule galaktoze nastaje: A) saharoza B) celuloza C) laktoza D) galaktoza E) fruktoza 60. riboza i fosfat B) adenozin. Zametni listići su slojevi stanica koji nastaju: A) brazdanjem B) gastrulacijom C) organogenezom D) histogenezom E) zbog posebne privlačnosti među stanicama 67.

_________________________________________________________________________ Pitanja 70. Testosteron se najjače izlučuje u: A) doba oplodnje B) embrionalno doba C) fetalno doba D) novorođenačko doba E) pubertetu 77. dan menstrualnog ciklusa B) 7. Neurosekrecijski faktori oslobađanja gonadotropnih hormona imaju kao glavni cilj tkivo: A) hipotalamusa B) hipofize C) uterusa D) dojke E) ovarija 80. Kod intermedijarnog nasljeđivanja u biljke zijevalice pojavljuju se u F2 generaciji i fenotipovi i genotipovi u omjeru: A) 1/2:1/2 B) 1/4:1/4:1/4:1/4 C) 3:1 D) 9:3:3:1 E) 1:2:1 71. dan menstrualnog ciklusa D) 21. Peptidnu vezu tvore skupine: A) OH i H B) COOH i NH2 C) COOH i COOH D) NH2 i NH2 E) COOH i OH 75. Modrozelene alge se razlikuju od bakterija po tomu što imaju: A) plastide B) kloroplaste C) klorofil D) jezgru E) jezgricu 73. Genetski materijal bakteriofaga je: A) DNK B) RNK C) polinukleotidni lanci obilježeni izotopom D) polipeptidni lanci obilježeni izotopom E) DNK iRNK 76. dan menstrualnog ciklusa E) 28. Blastocistu u svom razvoju imaju: A) morski ježinac B) vodozemci C) sisavci D) identični blizanci E) višejajni blizanci 167 . Ovulacija se događa na: A) 1. dan menstrualnog ciklusa C) 14. DNK možemo razlikovati od RNK po: A) broju C-atoma u šećerima B) broju H-atoma u šećerima C) fosfornoj kiselini D) sustavu pirimidina E) sustavu purina 78. Vezani geni se nalaze: A) samo na X kromosomu B) samo na autosomima C) na spolnim kromosomima D) na različitim kromosomima E) na istom kromosomu 72. dan menstrualnog ciklusa 79. Kloroplast se sastiji od: A) mikrofilamenata B) mikrotubula C) tilakoida D) endoplazmatskog retikuluma E) svi su odgovori točni 74. Adenohipofiza luči: A) testosteron B) estrogen C) progesteron D) gonadotropne hormone E) oksitocin 81.

34 nm C) 1 nm D) 2 nm E) 10nm 92.4 nm B) 0. Omjer fenotipova 75%:25% dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA 84. Svojstva i ulogu neke bjelančevine određuje: A) broj aminokiselina B) broj i vrsta aminokiselina C) broj. Promjer dvostruke uzvojnice DNK iznosi: A) 3. RNK prepoznajemo po prisutnosti: A) riboze i fosforne kiseline B) riboze i adenina C) deoksiriboze i uracila D) riboze i timina E) riboze i uracila 91. Enzimi: A) omogućuju kemijske reakcije u stanici B) mogu djelovati samo u stanicama C) se u stanicama nalaze u kristalnom stanju D) su dijelovi molekula vitamina E) djeluju kao hormoni 93. vrsta i raspored aminokiselina D) broj. Membranski proteini mogu biti: A) Djelomično hidrofilni B) djelomično hidrofobni C) enzimski aktivni D) u obliku kanalića E) sve su tvrdnje točne 85. Timin je: A) pirimidin B) purin C) vitamin D) nukleozid E) nukleotid 89. vrsta i raspored trideset raznih aminokiselina E) broj. Lipaza razgrađuje: A) maltozu B) škrob C) lipide D) proteine E) glukozu 168 . vrsta i raspored četrdesetak raznih aminokiselina 87.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 82. Interfaza je: A) razdoblje mirovanja stanica B) dioba kromosoma C) G1. Nukleotidi izgrađuju: A) nukleus B) nukleolus C) nukleoid D) adenozin E) polinukleotide 88. DNK i RNK ponašaju se kao kiseline zbog svojih: A) deoksiriboza B) riboza C) purinskih baza D) pirimidinskih baza E) fosfata 90. S i G2 faza D) vrijeme spiralizacije kromosoma E) vrijeme nestanka jezgrice 83. Aminokiseline se u bjelančevinama vežu: A) slabim vezama B) vodikovim vezama C) nekovalentnim vezama D) peptidnim vezama E) slabim kovalentnim vezama 86.

Trofoblast se razvija u: A) embrij B) fetus C) placentu D) blastoderm E) blastocel 100. U biologiju spada: A) citologija B) molekulska biologija C) taksonomija D) histologija E) svi su odgovori točni 169 . Prolaktin nastaje u: A) režnjevima hipofize B) hipotalamusu C) neurohipofizi D) adenohipofizi E) žlijezdanom tkivu dojke 98. Genotip recesivnog homozigota je: A) Aa B) aa C) AA D) AaBb E) AABB 102. U nukleolusu se sintetizira: A) DNK B) RNK C) gRNK D) tRNK E) rRNK 96. Zametni listići nastaju: A) iz blastocela B) trofoblasta C) blastule D) blastoderma E) blastoporusa 99. F1 generaciju dobiti ćemo križanjem roditelja: A) Aa x Aa B) Aa x aa C) AA x aa D) AaBb x AaBb E) AaBb x aabb 104. Blastomera je dio: A) neoplođenog jajeta B) zigote C) blastule D) gastrule E) blastocela 101. Omjer fenotipova 1:1 dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA 103._________________________________________________________________________ Pitanja 94. Korpus luteum luči: A) luteotropni hormon B) gonadotropne hormone C) FSH. Ako se geni A i C nalaze na dva razna mjesta istog kromosoma onda govorimo o: A) slobodnoj kombinaciji B) vezanim genima C) spolno vezanim genima D) monohibridnom nasljeđivanju E) intermedijarnom nasljeđivanju 105. Pasivni prijenos kroz membranu: A) odvija se od niže prema višoj koncentraciji tvari B) odvija se "nizbrdo" kao u osmozi i dijalizi C) odvija se uz utrošak energije D) odvija se pomoću membranskih prenosilaca E) troši ATP 95. LH i LTH D) progesteron i estrogen E) oksitocin 97.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 106. Mezoderm u žaba nastaje kretanjem stanica: A) u unutrašnjost blastule B) u arhenteron C) po površini gastrule D) ektoderma E) endoderma 117. Koji su parovi komplementarnih baza u RNK? A) adenin-timin B) citozin-uracil C) gvanin-citozin D) citozin-timin E) adenin-gvanin 112. Koji od navedenih organela nemaju membrane? A) mitohondriji biljnih stanica B) kloroplasti C) lizosomi D) ribosomi E) Golgijevo tijelo 107. Mejoza je dioba: A) jajnih stanica B) spermija C) slična mitozi D) spermatogeneze i oogeneze E) poznata samo u sisavaca 116. Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) "miješanje" očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip 170 . Ovulacija je: A) formiranje žutog tijela B) formiranje bijelog tijela C) izbacivanje jajašca iz Graafovog mjehurića D) putovanje jajne stanice u maternicu E) spajanje jajašca sa spermijem 114. Vezanjem jedne molekule glukoze i jedne molekule fruktoze nastaje: A) laktoza B) galaktoza C) saharoza D) fruktoza E) celuloza 111. U sastav adenina ne ulazi: A) vodik B) dušik C) sumpor D) ugljik E) kisik 110. Hormon testosteron: A) je gonadotropni hormon B) luče intersticijske stanice C) luče stanice adenohipofize D) ne luči se u pubertetu E) luči se tek u doba spolne zrelosti 115. riboze i fosfata C) adenozina. riboze i trifosfata D) adenina. Kojom se citološkom metodom služimo za proučavanje stanica izvan organizma? A) autoradiografijom B) svjetlosnim mikroskopom C) elektronskim mikroskopom D) kulturom stanica i tkiva E) svi su odgovori točni 109. Kada se udvostručuje DNK? A) u anafazi mitoze B) u anafazi mejoze C) u profazi mitoze D) u profazi mejoze E) u interfazi 108. riboze i trifosfata E) ništa od navedenog 113. riboze i fosfata B) adenozina. Molekula koja veže najveće količine energije u stanici sastoji se od: A) adenina.

U kemijskom sastavu gvanina nema: A) kisika B) natrija C) ugljika D) vodika E) dušika 127. Koji od navedenih genotipova može biti potomak roditelja AABB x aabb? A) AaBB B) aaBB C) aabb D) AaBb E) AAbb 120. Geološko razdoblje karbon ili ugljeno doba značajno je po razvoju: A) gljiva B) alga C) papratnjača D) golosjemenjača E) kritosjemenjača 124. U kojem omjeru ih treba očekivati od ukupno 120? A) 60 dugih i 60 kratkih B) 80 dugih i 40 kratkih C) 90 dugih i 30 kratkih D) 70 dugih i 50 kratkih E) 100 dugih i 20 kratkih 119. Prijelaz tvari između dviju otopina različitih koncentracija odvojenih opnom zove se: A) osmoza B) difuzija C) dijaliza D) aktivan prijelaz E) svi su odgovori točni 129. riboza i fosfat B) adenozin. Omjeri fenotipova u F2 generaciji intermedijarnog križanja su: A) 9:3:3:1 B) 3:1 C) 1:2:1 D) 1:1 E) 1:1:1:1 121. Za endoplazmatsku mrežicu vezani su: A) mitohondriji B) kloroplasti C) centrioli D) ribosomi E) lizosomi 125. Naziv ATP je kratica za molekulu sljedećeg sastava: A) adenin. U sastav kože ne ulaze stanice: A) žlijezda znojnica 171 . Znanost koja se bavi odnosima u biocenozi i odnosima biocenoze i okoliša zove se: A) ekologija B) biocenologija C) biogeografija D) biogeokemija E) fitocenologija 123. Konačni proizvod fotosinteze je: A) CO2 B) H2O C) NADP-H2 D) C6H12O6 E) O2 126._________________________________________________________________________ Pitanja 118. riboza i trifosfat C) adenozin i trifosfat D) adenozin i fosfat E) ništa od navedenog 128. Križanjem graška duge i kratke stabljike dobijeno je i potomstvo duge i kratke stabljike. Mutacije gena su uvijek: A) spontane mutacije B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 122.

Što je karakteristično za oogenezu? A) dvije redukcijske diobe B) jedna mejotička dioba C) nema mitoze D) tri diploidne polocite E) jedna haploidna jajna stanica 131. Genotip jednog roditelja je AaBb. Mutacije spolnih stanica se pojavljuju: A) u muškim spolnim stanicama B) u ženskim spolnim stanicama C) u određeno vrijeme D) u sljedećim generacijama 172 .ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) žlijezda lojnica C) dlake D) masnog tkiva E) hrskavice 130. Koje križanje ima kao rezultat uniformnost potomstva: A) test križanje B) monohibridno C) dihibridno D) križanje roditeljske (P) generacije E) križanje filijalne F1 generacije 138. Nasljeđivanje: A) je prenošenje osobina na potomstvo B) vrši se preko jajeta C) vrši se preko spermija D) je spajanje gameta E) nijedan odgovor nije točan 137. Što od navedenog ne odgovora prvoj mejotičkoj diobi? A) konjugacija kromosoma B) spiralizacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) odvajanje centriola 132. Koji je genotip drugog roditelja ako je omjer potomstva 1/4 : 1/4 : 1/4 : 1/4? A) aaBB B) AAbb C) AaBB D) AABB E) aabb 139. Za vrijeme gastrulacije posebnom aktivnošću endodermalnih stanica nastaje: A) mezoderm u sisavaca B) trofoblast u sisavaca C) mezoderm u ježinaca D) sekundarna tjelesna šupljina E) ništa od navedenog 135. Kakve cvjetove ima zijevalica u F1 generaciji: A) crvene cvjetove B) bijele cvjetove C) ružičaste cvjetove D) ima i crvenih i bijelih cvjetova E) ima crvenih. Od kojeg se zametnog listića razvije živčano tkivo? A) od mezoderma B) od ektoderma C) od bilo kojeg zametnog listića D) od endoderma E) svi su odgovori točni 134. Arhenteron je šupljina: A) koja odgovara blastocelu B) koja odgovara blastoporusu C) pracrijeva D) obavijena mezodermom E) obavijena ektodermom 133. bijelih i ružičastih cvjetova 140. Adenohipofiza luči velike količine prolaktina: A) u trudnoći B) neposredno prije poroda C) neposredno nakon poroda D) za vrijeme ovulacije E) za vrijeme oplodnje 136.

_________________________________________________________________________ Pitanja E) zajedno sa somatskim mutacijama 141. Molekulska biologija proučava: A) sve molekule u prirodi B) uzajamno djelovanje makromolekula C) male molekule stanica D) velike molekule žive i nežive prirode E) metabolizam 147. Procesi smjenjivanja biocenoze na nekom prostoru spadaju u: A) evoluciju B) sukcesiju C) melioraciju D) fenološku pojavu E) svi su odgovori točni 144. Fotosinteza je predočena jednadžbom: A) CO2 + H2O → C6H12O6 + H2O B) 6CO2 + 6H2O → C6H12O6 + 6O2 + 6H2O C) 6CO2 + 12H2O → C6H12O6 + 6O2 + 6H2O 173 . DNK se sintetizira: A) udvostručavanjem ishodišne molekule B) na kalupu RNK C) od pojedinačnih baza D) od parova baza E) od dinukleotida 151. Enzimi su: A) organske molekule male molekuske mase B) anorganske molekule C) bjelančevine D) vitamini E) hormoni 152. Bjelančevine su izgrađene od: A) aminokiselina B) glicina C) alanina D) glicil-alanina E) dipeptida 148. Pramajmun nazvan prophilopitekus živio je u: A) eocenu B) oligocenu C) miocenu D) pliocenu E) pleistocenu 146. Koliko milijardi godina su stari prvi tragovi organizama na zemljinoj kori? A) 1. Mjerilo gustoće svake populacije je: A) abiotski činilac B) skup ekoloških činilaca C) skup bioloških činilaca D) biomasa E) ekološka valencija 143. DNK prepoznajemo po prisustvu: A) riboze i citozina B) gvanina C) adenina D) deoksiriboze i timina E) deoksiriboze i uracila 150.5 B) 2 C) 2. Gvanin je: A) pirimidin B) purin C) nukleozid D) nukleotid E) polinukleotid 149. Genetičke šifre UAG i UAA A) ne znače ništa (nonsense code) B) su degenerirane šifre za leucin C) su degenerirane šifre za prolin D) su degenerirane šifre za arginin E) su degenerirane šifre za serin 142.5 D) 3 E) 4 145.

Purkinje C) M. Blastula je konačni proizvod: A) oplodnje B) organogeneze C) brazdanja D) metamorfoze E) gastrulacije 158. Brown 156. traje: A) 38 tjedana B) 40 tjedana C) 42 tjedna D) 270 dana E) 9 mjeseci 159. Križanjem graška duge stabljike (Aa) s kratkom (aa) dat će omjer fenotipova: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 1 : 2 : 1 161. Na proizvodnju mlijeka nakon poroda utječu: A) estrogeni u ovarija B) progesteron iz luteinskih stanica C) prolaktin iz adenohipofize D) oksitocin iz adenohipofize E) gonadotropni hormoni 157. Virchow B) J. Poznati aksiom "Svaka stanica od stanice" dao je: A) R. Schwann E) R. računajući od prvog dana poslijednje menstruacije. Schleiden D) Th. Embriologija proučava: A) razvoj vrste B) razvoj jedinke od njenog začeća do rođenja C) samo embrij D) samo fetus E) samo gastrulu 163. Bjelančevine ubrajamo u: A) male organske molekule 174 . Disaharid laktoza sastoji se od: A) glukoze i glukoze B) glukoze i fruktoze C) glukoze i galaktoze D) galaktoze i galaktoze E) fruktoze i fruktoze 164. Trudnoća u čovjeka. Gonadotropni hormoni utječu na: A) hipotalamus B) adenohipofizu C) neurohipofizu D) gonade E) klimakterij 155.+ 2NADP + 4e.→ 2NADP-H2 E) ADP + P + ENERGIJA → ATP 153. J. Omjer fenotipova 9 : 3 : 3 : 1 dat će roditelji: A) Aa x Aa B) AA x aa C) AABB x aabb D) AaBb x aabb E) AaBb x AaBb 160.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) 4H. Evolucija proučava: A) postanak jedinke B) razvoj jedinke od začeća do rođenja C) embrionalni razvoj čovjeka D) postanak vrsta E) razvoj odnosa žive i nežive prirode 162. Kodon UUU u glasničkoj RNK uvjetuje ugradnju sljedeće aminokiseline u rastući peptidni lanac: A) metionina B) lizina C) serina D) fenilalanina E) valina 154.

Puno ima NADP iz svjetlosnih reakcija fotosinteze glasi: A) adenozin difosfat B) nikotin-adenin difosfat C) nikotinamid-adenin difosfat D) nikotinamid-adenin dinukleotid E) nikotinamid-adenin dinukelotid fosfat 173. Što se od navedenog ne nalazi u eukariotskim stanicama? A) bičevi B) cilije C) vaukole D) nukleoidi E) stanična stijenka 167._________________________________________________________________________ Pitanja B) velike anorganske molekule C) polinukleotide D) polisaharide E) makromolekule 165. Stanična jezgra u interfazi: A) sadrži kromosome B) ima jednostruku opnu C) prisutna je u toku čitavog staničnog ciklusa D) sadrži jezgrin sok i kromatin E) prisutna je u svim stanicama čovječjeg tijela 175. Citozin je: A) pirimidin B) purin C) vitamin D) aminokiselina E) nukleotid 169. Polinukleotid je sastavljen od mnogo: A) aminokiselina B) polipeptida C) dušičnih baza D) nukleotida E) adenozina 170. U sastav proteina ulazi sljedeći broj različitih prirodnih aminokiselina: A) 5 B) 10 C) 15 D) 20 E) 25 166. ATPaza razgrađuje: A) AMP B) ADP C) ATP D) škrob E) maltozu 171. Nukleotidi izgrađuju: A) šećer B) lipide C) polisaharide D) enzime i proteine E) nukleinske kiseline 168. Aktivni prijenos kroz membranu: A) odvija se od više prema nižoj koncentraciji tvari B) teče "nizbrdo" C) odvija se uz pomoć prenosilaca i energije D) uključuje dijalizu i osmozu E) predstavlja difuziju 174. Adenozin monofosfat je: A) purinska baza B) pirimidinska baza C) spoj baze i šećera D) nukleotid E) energetski vrlo bogat 172. Intersticijske stanice testisa: A) luče testosteron B) luče faktore oslobađanja hormona hipofize C) predstavljaju germinativni epitel D) luče gonadotropne hormone E) aktivne su samo u toku puberteta 175 .

Kako će se prepisati genetska poruka koja na molekuli DNK ima sljedeći redoslijed baza TAGGCCA? A) TUGGCCU B) AUGGCCU 176 . ICSH (engl. koji se sastoje od dviju kromatida. Interstitial Cell Stimulating Hormone) djeluje na: A) folikule B) uterus C) dojku D) testis E) intersticijske stanice 177. Križanjem graška duge stabljike (AA) s kratkom (aa) dati će u potomstvu omjer: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 100% dugih 180. Embrioblast se razvija u: A) placentu B) resice C) embrij D) blastoderm E) blastocel 178. Intermedijarno nasljeđivanje pokazuje u F2 generaciji: A) jednu klasu fenotipova B) dvije klase fenotipova C) tri klase fenotipova D) proporciju 3 : 1 E) proporciju 1 : 1 181.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 176. Anafaza I je značajna po: A) razdvajanju centriola B) udvostručavanju pričvrsnica C) razdvajanju kromatida D) razdvajanju kromosoma E) konjugaciji kromosoma 184. Žuto tijelo izlučuje: A) LH B) LTH C) FSH D) ICSH E) progesteron 186. Bakterijskom nukleoidu u eukariota po funkciji odgovara: A) nuklein B) nukleolus C) nukleotid D) kromosom E) nukleozid 183. Haploidan broj kromosoma. F2 generaciju dobit ćemo križanjem roditelja: A) aa X AA B) aa X aa C) AA X AA D) aA X AA E) aA X aA 179. Golgijevo tijelo se nalazi: A) samo u životinjskim stanicam B) samo u biljnim stanicama C) u stanicama eukariota D) u bakterijama E) u virusima 182. nalazimo u: A) profazi I B) metafazi I C) anafazi I D) telofazi I E) telofazi II 185. Genetička šifra koja daje uputu za sintezu polipeptida koji se sastoji isključivo od fenilalanina je sljedeća: A) GUA B) CUC C) AUC D) AUA E) UUU 187.

U aktiviranoj zigoti najprije se javljaju: A) nove stanice B) mejotičke diobe C) mitotičke diobe D) blastomere E) sve su tvrdnje točne 190. Međusobnim križanjem roditelja istih genotipova CcDd dobiva se potomstvo u sljedećem omjeru: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 3 : 1 197. Koliko ima različitih fenotipova u F2 generaciji dihibridnog križanja: A) 16 B) 9 C) 8 D) 4 E) 2 192. a sada su ograničene na uže područje zovu se: A) biomi 177 . Koji od navedenih primjera odgovara gameti zadanog roditelja AaBb: A) aa B) bb C) Aa D) Bb E) niti jedan odgovor nije točan 196. Omjer genotipova i fenotipova 1 : 1 dobiva se križanjem roditelja: A) BB x bb B) Bb x Bb C) Bb x bb D) Bb x BB E) bb x bb 198. Vrste kojima je areal rasprostranjenosti u prošlosti bio mnogo širi. Koji produkt sinteze očekujemo od redoslijeda nukleotida na lancu DNK: CGTATGCGTACGCAAGCACCA? A) monopeptid B) dipeptid C) tripeptid D) polipeptid E) ništa od navedenog 189._________________________________________________________________________ Pitanja C) TUGGCCU D) AUCCGGU E) TAGGCCT 188. Koji od navedenih roditelja mogu dati potomstvo koje za jedno svojstvo pokazuje omjer 3 : 1: A) aabb x AABB B) AABb x aaBB C) aaBb x aaBb D) AaBb x aabb E) aabb x aaBb 193. Koja je od navedenih zigota po fenotipu različita od svih ostalih? A) AaBB B) AABb C) AABB D) AAbb E) AaBb 191. Omjer genotipova u F2 generaciji intermedijarnog križanja je sljedeći: A) 1 : 1 B) 3 : 1 C) 1 : 1 : 1 : 1 D) jednak je omjeru fenotipova E) ništa od navedenog 195. Geni A i b nalaze se na različitim kromosomima pa zato govorimo o: A) intermedijarnom nasljeđivanju B) monohibridnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanim genima 194.

Biljna stanica. Kloroplaste nalazimo u: A) bakterija B) životinja C) prokariota D) biljaka E) virusa 204. Bakteriofagi predstavljaju viruse koji napadaju: A) biljne stanice B) životinjske stanice C) bakterijske stanice D) ljudske stanice E) eukariotske stanice 205. Zeleni pigment koji omogućuje fotosintezu nalazi se u: A) jezgri B) mitohondriju C) ribosomu D) endoplazmatskoj mrežici E) kloroplastima 208. Biologija je znanost o: A) biljkama B) životinjama C) čovjeku D) životu E) jednostaničnim organizmima 200. Deoksiribonukleinska kiselina sastavljena je od: A) nukleusa B) nukleolusa 178 . Najvažnija anorganska molekula našeg tijela je: A) šećer B) voda C) protein D) mast E) DNA 210. Eukariotska stanica: A) nema jezgru B) ima jezgru C) otkrivena je elektronskim mikroskopom D) velika je 1 mikrometar E) je stanica bakterije 201. Biljna stanica. za razliku od životinjske ima sposobnost: A) mitotičkih dioba B) metabolizma C) disanja D) fotosinteze E) mejotičkih dioba 207.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) populacije C) relikti D) endemi E) svi su odgovori točni 199. Bakterija je: A) eukariotska stanica B) prokariotska stanica C) stanica s jezgrom D) životinjska stanica E) stanica bez DNA 202. Jezgru nalazimo u: A) virusa B) bakterija C) prokariota D) eukariota E) eritrocitima čovjeka 206. za razliku od životinjske ima: A) ribosome B) jezgru C) citoplazmu D) staničnu stijenku E) staničnu membranu 209. Ribosomi su zrnca na kojima se odvija sinteza: A) DNA B) RNA C) proteina D) masti E) šećera 203.

DNA ima u svom sastavu šećer: A) ribozu B) heksozu C) saharozu D) triozu E) deoksiribozu 212. DNA je odgovorna za sintezu: A) masti B) ugljikohidrata C) bjelančevina D) lipida E) steroidnih hormona 216. Brazdanje završava oblikom zametka koji zovemo: A) blastula B) gastrula C) zigota D) blastocel E) blastoderm 220. DNA izgrađuje: A) ribosome B) citoplazmu C) mitohondrije D) gene E) membrane 215. Adenin je: A) šećer B) aminokiselina C) purin D) pirimidin E) hormon 213. Anatomija istražuje: A) mikroskopsku građu živih bića B) mikroskopsku građu pojedinih organa C) makroskopsku građu živih bića D) pojedine sustavne kategorije živih bića E) međusobne odnose pojedinih organa 223. Pentapeptid je lanac sastavljen od: A) 3 aminokiseline B) 5 aminokiselina C) 7 aminokiselina D) 3 glukoze E) 5 nukleotida 218. Ekologija proučava: 179 . Citozin je: A) polisaharid B) polipeptid C) pirimidin D) purin E) vitamin 214. Gonadotropne hormone luči: A) cijela hipofiza B) prednji režanj hipofize C) stražnji režanj hipofize D) hipotalamus E) sjemenik 221._________________________________________________________________________ Pitanja C) nukleoida D) nukleotida E) riboza 211. Molekula RNA najčešće je: A) jednolančani polinukleotid B) dvolančani polinukleotid C) jednolančani polisaharid D) dvolančani polisaharid E) trolančani polipeptid 217. Genetska šifra sastoji se od: A) jednog nukleotida B) dva susjedna nukleotida C) tri susjedna nukleotida D) četiri susjedne aminokiseline E) pet susjednih aminokiselina 219. Estrogene i progesteron luče: A) hipotalamus B) stražnji režanj hipofize C) prednji režanj hipofize D) jajnik E) sjemenik 222.

Gamete dihibridnog križanja su sljedeće: A) Aa B) Bb C) AA D) Ab E) svi su odgovori točni 233. Koje od spomenutih križanja daje potomstvo u omjeru 1 : 1: A) AaBb x AAbb B) Aa x aa C) Aa x Aa D) AA x aa E) nijedno 231. Koliko kromosoma imaju gamete vinske mušice? A) 2 180 . Koje od navedenih križanja nije test križanje? A) Aa x aa B) Bb x bb C) AAbb x aaBB D) AaBb x aabb E) Aabb x aaBb 232. Koje od navedenih baza nema DNK? A) citozina B) uracila C) timina D) gvanina E) adenina 228.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ A) uzajamne odnose žive i nežive prirode B) postanak vrsta u prirodi C) uzroke sličnosti i razlika među organizmima D) funkciju pojedinih staničnih dijelova E) pojedine vrste živih bića 224. U prevođenju genetičke poruke jedna je aminokiselina određena: A) s jednom bazom B) s tri baze C) s četiri baze D) s dvije baze E) svi odgovori mogu biti točni 227. Gvanin se veže za: A) uracil B) adenin C) citozin D) timin E) bilo koju pirimidinsku bazu 229. Koji je omjer fenotipova u potomstvu koje dobijemo križanjem AaBb x AaBb ako su geni vezani i među njima nema krosingovera? A) 1 : 1 B) 3 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 1 : 1 : 1 : 1 234. Koji je od navedenih primjera homozigot samo za 1 par alela: A) aAbB B) aaBB C) AABB D) aabb E) aaBb 230. Koji je od navedenih elemenata neophodan za život za razliku od ostalih koji se javljaju samo u tragovima: A) Cl B) H C) Mn D) Zn E) J 225. Tirozin i serin spadaju u: A) aminokiseline B) purinske baze C) pirimidinske baze D) nukleotide E) ni jedan odgovor nije točan 226.

FSH. Promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 243. Koliko % muške djece će imati hemofiliju ako je majka prenosilac. Prvi antibiotik je otkrio: A) L. Fleming D) R. Od trofoblasta će se razviti: A) blastoderm B) posteljica (placenta) C) tijelo embrija D) embrioblast E) amnion ili alantois 240. Koji od navedenih genotipova spada u P (parentalnu ili roditeljsku) generaciju? A) aaBb B) aabb C) AaBB D) AABb E) Aabb 236. Virusi nemaju: A) jezgre B) ribosome C) membrane D) RNK i DNK zajedno E) svi su odgovori točni 239. a otac zdrav? A) 50% B) 25% C) 100% D) 75% E) Svi će sinovi biti zdravi 237. LH i LTH proizvodi su: A) ovarija B) testisa C) hipofize 181 . Haeckel 244. Koch C) A. Pasteur B) R. Ekologiji danas pripada zadatak da ispita odnos: A) biljaka prema životinjama B) nežive prirode prema biljkama C) nežive prirode prema životinjama D) čovjeka prema fizičkim faktorima okoline E) čovjeka prema ostaloj prirodi 241. Što se događa u anafazi I mejotičke diobe? A) konjugacija homolognih kromosoma B) redukcija broja kromosoma C) odjeljivanje homolognih kromosoma D) odjeljivanje kromatida svakog kromosoma E) sve navedeno 238. Virchow E) E. Crossing over omogućuje postanak novih vrsta gameta u: A) monohibridnih homozigota B) monohibridnih heterozigota C) dihibridnih homozigota D) dihibridnih heterozigota u slobodnoj kombinaciji E) dihibridnih heterozigota s vezanim genima 242._________________________________________________________________________ Pitanja B) 4 C) 6 D) 8 E) ni jedan od navedenih 235. Homologni kromosomi uključuju u svojem paru: A) kromosom 1 i kromosom 21 B) kromosom 2 i kromosom 22 C) kromosom 5 i kromosom 15 D) kromosom 8 i kromosom 18 E) kromosom X i kromosom Y 245.

Obzirom na sastav svojih spolnih kromosoma. Prolaktin nastaje u: A) hipotalamusu B) adenohipofizi C) neurohipofizi D) dojci E) mliječnim mjehurićima 247. među kojima je jedno dijete albino. Otac koji normalno raspoznaje boje i majka daltonist imat će: A) sve kćeri daltoniste B) svu djecu daltoniste C) sve sinove daltoniste D) svu djecu normalnu E) sve sinove normalne 248. Djed albino (aa. dvije različite vrste stanica nalazimo među: A) jajnim stanicama B) somatskim stanicama žena C) somatskim stanicama muškaraca D) spermatogonijama E) spermijima 250. Jednak broj ženka i mužjaka u potomstvu drozofile nastaje stoga što vinska mušica ima: A) jednaki broj jajnih stanica s X i onih sa Y kromosomima B) jednaki broj spermija s X i onih sa Y kromosomima C) 3 para autosoma i 1 par spolnih kromosoma D) 6 autosoma i 2 X kromosoma E) ukupno 8 kromosoma 251.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) hipotalamusa E) neurohipofize 246. Ona je u svom braku imala četvoro djece. autosomsko recesivno svojstvo) i baka normalne pigmentacije (AA) imali su kćer normalne pigmentacije. Križanje roditelja AaBbCC s reoditeljem AaBbCC dati će u potomstvu sljedeći omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 3 : 1 D) 1 : 1 : 1 : 1 E) uniformnu generaciju (100%) 253. Kakvog je genotipa najvjerojatnije bio otac? A) AA B) Aa C) XY D) XX E) XXY 249. Križanjem genotipa Aabb s aaBb dobit ćemo u njihovom potomstvu omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 1 D) 1 : 1 : 1 : 1 E) 1 : 2 : 1 252. Vezani geni moraju se nalaziti na: A) X kromosomu B) Y kromosomu C) prvom kromosomu D) dvadesetprvom kromosomu E) istom kromosomu 255. ATP se dobiva spajanjem: A) adenozina s monofosfatom B) adenozina s difosfatom C) AMP + P 182 . Križanje roditelja AAbbCC i aaBBcc dati će potomstvo sa sljedećim genotipom: A) AABBCC B) AaBbCc C) aabbcc D) 50% AaBbCc i 50% aabbcc E) 50% AABBCC i 50% AaBbCc 254.

Pomoću adenozin trifosfata u stanicama se obavlja sljedeće: A) sintetske aktivnosti B) proizvodnja topline C) proizvodnja podražaja D) kretanje E) svi su odgovori točni 257. Od endoderma nastaju: A) bubrezi B) vezivna tkiva C) spolne žlijezde D) krvne žile E) sluznica probavila 265. Koji od navedenih primjera odgovara test križanju: A) aa x AA B) aa x Aa C) Aa x Aa D) AaBb x AaBb E) aaBB x AAbb 267. Test križanje se primjenjuje: A) da bi se otkrio genotip dominantnog fenotipa B) da bi se otkrio genotip recesivnog fenotipa C) samo u monohibridnom križanju D) samo u dihibridnom križanju E) u intermedijarnom križanju 266. Blastocel je: A) otvor blastule B) otvor gastrule C) šupljina blastule D) šupljina gastrule E) osnova celoma 262. U ježinaca se mezoderm razvija od stanica: A) animalnog pola blastule B) vegetativnog pola blastule C) gastrule D) endoderma E) ektoderma 263. Za mitozu je karakteristično: A) dioba kromosoma B) reduplikacija DNK C) redukcijska dioba kromosoma D) jednak broj kromosoma u novim stanicama E) dioba centriola 259. U monohibridnom križanju s dominacijom omjer fenotipova u F2 generaciji je sljedeći: A) 1 : 2 : 1 183 . Pričvrsnica je posebno mjesto na: A) centriolu B) endoplazmatskoj mrežici C) Golgijevom tijelu D) kromatinu E) kromosomu 260. Živčani sustav razvija se od: A) mezoderma B) endoderma C) trbušnog ektoderma D) bočnog ektoderma E) leđnog ektoderma 264. Stanicu je prvi opazio: A) Leeuwenhoek B) Hooke C) Schleiden D) Schwann E) Buchner 258. Nukleoidi su: A) jezgrice B) jezgre C) područja s DNK u bakterija D) spolni kromosomi E) kariotipovi 261._________________________________________________________________________ Pitanja D) ADP + P E) adenina s trifosfatom 256.

Koje od navedenih baza nema u RNK? A) gvanina B) adenina C) uracila D) timina E) citozina 277. Fiziologija proučava: A) čovjeka B) funkcije pojedinih organa C) životinje D) biljke E) biljna i životinjska tkiva 271. Nauka o evoluciji proučava: A) uzajamne odnose živih bića B) postanak vrsta u prirodi C) pojedine vrste životinja D) pojedine vrste biljaka E) funkciju pojednih organa 272. Kojoj aminokiselini odgovara slijed baza UUU u g-RNK: A) glicinu B) lizinu C) valinu D) argininu E) fenilalaninu 270. Adenin i uracil spadaju u: A) peptide B) aminokiseline C) dušikove baze D) nukleinske kiseline E) nukleotide 274. Koliko različitih gameta može dati genotip AaBb ? A) 1 B) 2 C) 3 D) 4 E) 8 269. Za Golgijevo tijelo nije točno: A) da spada u stanične organele B) da se sastoji od kanalića C) da ima ribosome D) da se nalazi u žlijezdanim stanicama E) da se nalazi u biljnim stanicama 275.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) 3 : 1 C) 1 : 1 D) 1 : 1 : 1 : 1 E) 9 : 3 : 3 : 1 268. Autoradiografija: A) pomaže kod proučavanja staničnog metabolizma B) zasniva se na primjeni nestabilnih radioaktivnih izotopa C) pomaže kod praćenja sinteze molekula D) pomaže kod praćenja raspada molekula u stanici E) svi su odgovori točni 273. Koji je od spomenutih primjera recesivan za jedan par alela ? A) Aabb B) aaBB C) aaBb D) AAbb E) svi primjeri 184 . Za ribosome je značajno: A) da su obavijeni membranom B) da su uvijek vezani za membrane endoplazmatske mrežice C) da se nalaze u svim tipovima stanica D) da u svome sastavu nemaju bjelančevina E) da u svome sastavu nemaju enzima 276. Kemijski sastojci stanične membrane su: A) RNK B) DNK C) svi tipovi nukleinskih kiselina D) lipidi E) sve navedeno 278.

Ako je majka prenosilac hemofilije a otac hemofiličar. Koji omjer genotipova dobijemo u potomstvu ako križamo AABB x Aabb uz pretpostavku da se radi o vezanim genima? A) isti kao i omjer fenotipova B) svi su genotipski jednaki C) isti kao da geni nisu vezani D) 3 : 1 E) 1 : 1 : 1 : 1 283. Koji je diploidan broj kromosoma u drozofile: A) 4 B) 6 C) 8 D) 10 E) 12 285. Vezani geni se nalaze: A) na različitim kromosomima a određuju ista svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu a određuju različita svojstva D) na istom kromosomu bez obzira na svojstva koja određuju E) jedino na kromosomima vinske mušice 281. Aleli su geni: A) koji kontroliraju jedan drugog B) koji mogu biti u odnosu dominacije i recesivnosti C) u parovima za svako svojstvo D) na paru homolognih kromosoma E) svi su odgovori točni 288._________________________________________________________________________ Pitanja 279. Genotipovi F2 (druge sinovske) generacije mogu biti: A) AaBB B) aaBb C) AaBb D) Aabb E) svi navedeni 287. to zanči da je dominantni fenotip roditelja morao biti sljedećeg genotipa: A) AaBB B) AABB C) aaBb D) AABb E) Aabb 286. Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) AaBB x AAbb C) Aabb x aaBb D) Aa x aa E) Bb x bb 280. koja je vjerojatnost da njihova djeca dobiju hemofiliju ? A) 25% ženske djece B) 50% muške i 50% ženske djece C) 100% ženske djece D) 100% muške djece E) nijedan odgovor nije točan 284. Gamete dihibridnog križanja su sljedeće: A) Ab B) AA C) Bb D) Aa E) svi su odgovori točni 282. Ako u dihibridnom test križanju ne dobijemo cijepanje alela u potomstvu nego su svi potomci jednaki. Virusi imaju: A) staničnu membranu B) staničnu stijenku C) ribosome D) RNK i DNK E) sve gore navedeno 185 .

aleli. Ribonukelinsku kiselinu prepoznajemo po prisustvu: A) citozina B) gvanina C) adenina D) pentoze E) uracila 296. Tripansoma spada u: A) zelene alge B) zelene bičaše C) korijenonošce D) truskovce E) praživotinje 293. Križanac ili hibrid prikazan je sljedećim genotipom: A) AABBCC B) aabbcc C) AAbbCC D) aaBBcc E) AABbCC 292. Sintezu proteina prema genetskoj uputi zapisanoj u glasničkoj RNK zovemo: A) prepisivanje B) udvostručavanje C) mutiranje D) čitanje E) prevođenje 297. Struktura i funkcija svake ljudske stanice ovisi prvenstveno o njenim: A) lipidima B) ugljikohidratima C) nukleinskim kiselinama D) proteinima E) RNK 295. Omjer od 3/4 graška duge stabljike prema 1/4 biljaka kratke stabljike dobivamo križanjem: A) dviju biljaka kratke stabljike B) dviju biljaka dugih stabljika (homozigotnih) C) dviju biljaka dugih stabljika (heterozigotnih) D) kratkih s dugim biljkama (homozigotnih) E) kratkih s dugim biljkama (heterozigotnih) 299. nastaju: A) prevođenjem genske upute B) prepisivanjem genske upute C) udvostručavanjem D) mutiranjem E) čitanjem 298. Četiri različite vrste gameta dati će jedinka genotipa: A) Aa B) AA C) AAbb D) AaBb E) AaBbCc 186 . Novi oblici gena. Čovjek kao i sva druga živa bića pokazuje sljedeće značajke: A) staničnu građu B) individualnost C) metabolizam D) razmnožavanje E) sve nabrojene 290. Izrazito polarna molekula našeg tijela je: A) kolesterol B) mast C) steroidni hormon D) estrogen E) voda 294. Golgijevo tijelo nalazimo u: A) mitohondrijima B) citoplazmi C) ribosomima D) jezgri E) jezgrici 291.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 289.

9% NaCl i eritrociti čovjeka u njoj ostaju neoštećeni. Watsona E) A. Broj jedinki neke vrste ne određenom prostoru predstavlja njenu: A) biomasu B) populaciju C) gensku snagu D) konkurenciju E) simbiozu 304. Morgana C) F. Ostatak repića u novorođenčeta predstavlja: A) relikt B) mutaciju C) rudiment D) endem E) edem 308. Dvije različite vrste gameta dati će jedinka genotipa: A) AA B) aa C) AaBB D) AaBb E) AaBbCc 301. Fiziološka otopina sadrži 0. Poliuridilnu kiselinu predočuje: A) uridin-uridin B) AAA AAA C) UUA UUA D) AUG AUG E) poliU 310.2 i 3 čine u kariotipu skupinu: A) A B) B C) C D) D E) E 302. Kodoni predstavljaju trojke nukleotida u: A) DNK B) virusnoj RNK C) ribosomskoj RNK D) transportnoj RNK E) glasničkoj RNK 309. Hersheya 305. Što se od navedenog nalazi i u bakterija i u modrozelenih algi ? A) ribosomi B) kloroplasti C) mitohondriji D) lizosomi E) ništa od navedenog 306. Pojam genetič ka karta potječe iz znanstvenog rada: A) G. Cricka D) J._________________________________________________________________________ Pitanja 300. Humana genetika raspoređuje gene čovjeka u genetičke karte. Fiziološka je otopina dakle prema eritrocitima: A) monotonična B) izotonična C) hipertonična D) hipodonična E) atonična 303. Ljudski kromosomi 1. Atavizmima se najintenzivnije bavi: A) genetika B) pedijatrija C) kirurgija D) citologija E) evolucija 307. Mendela B) T. Polifenilalanin nastavit će u toku sinteze bjelančevine na kalupu sljedeće ribonukleinske kiseline: A) AAA B) UUU AAA 187 .

Glicin i alanin spadaju u: A) nukleinske kiseline B) nukleotide C) dušikove baze D) peptide E) aminokiseline 317. Vezanim genima nazivamo gene koji se nalaze: A) na istom kromosomu a određuju različita svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu bez obzira na svojstva koja određuju D) na različitim kromosomima a određuju ista svojstva E) nijedan odgovor nije točan 321. Koji je od spomenutih primjera dominantan fenotip ? A) Aa B) AA C) AaBb D) AABb E) svi navedeni primjeri 319. Pirimidinske baze su: A) dušične baze B) citozin C) timin D) uracil E) svi su odgovori točni 318. Ekologija je nauka o: A) pojedinim vrstama životinja B) pojedinim vrstama biljaka C) pojedinim vrstama živih bića D) međusobnim odnosima živih bića i njihove okoline E) postanku vrsta u prirodi 314. Hipoglikemija je: A) nedostatak minerala u organizmu B) pomanjkanje tekućine u organizmu C) smanjena razina glukoze u krvi D) nedostatak vitamina C E) nedostatak vitamina D 315. Koji od navedenih primjera nije recesivan samo za jedan par alela ? A) aaBb B) AAbb C) aaBB D) Aabb 188 . Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) Aabb x aaBb C) Aa x aa D) AA x Aa E) Bb x bb 320. Genetska uputa u molekule DNK za ugradnju aminokiseline fenilalanin u peptidni lanac glasi: A) UUU B) TTT C) AAA D) CCC E) GGG 312. Histologija je nauka o: A) biljkama B) životinjama C) funkciji pojedinih organa D) biljnim i životinjskim tkivima E) međusobnom djelovanju tkiva i organa 313. Steroidi su: A) posebna skupina lipida B) spolni hormoni C) hormoni kore nadbubrežne žlijezde D) neki vitamini E) svi su odgovori točni 316.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ C) TTT UUU AAA D) UUU UUU UUU UUU E) AAA AAA AAA AAA AAA 311.

Što je embrioblast: A) svaka skupina embrinalnih stanica B) skupina embrionalnih stanica u sisavaca nakon brazdanja C) isto što i trofoblast D) odgovara zametnim listićima E) sudjeluje u formiranju posteljice 189 ._________________________________________________________________________ Pitanja E) aabb 322. Cijepanje osobina se javlja: A) u parentalnoj generaciji B) u F1 generaciji C) u F2 generaciji D) samo u test križanju E) ništa od navedenog 330. Nije točno da modrozelene alge imaju: A) klorofil B) kloroplaste C) nukleoid D) jednostavnu steljku E) posebnu boju 328. Koji od navedenih omjera odgovara rezultatu test križanja ? A) 9 : 3 : 3 : 1 B) 1 : 1 : 1 : 1 C) 3 : 1 D) 1 : 2 : 1 E) niti jedan 323. Ako križamo AaBb x aabb a geni su vezani i nema krosingovera. Ako je majka slijepa za boje a otac nije. koji omjer dobivamo kod potomstva? A) 1 : 1 B) 1 : 1 : 1 : 1 C) 9 : 3 : 3 : 1 D) 3 : 1 E) 1 : 2 : 1 324. koliko je njihove djece slijepo za boje? A) sva muška djeca B) sva ženska djeca C) 50% muške djece D) 50% ženske djece E) nijedan odgovor nije točan 326. Bakteriofagi nemaju: A) DNK B) proteinsku ovojnicu C) “glavice” D) “repa” E) membrane 332. Za I mejotičku diobu nije točno da dolazi do: A) odvajanja homolognih kromosoma B) odvajanja kromatida svakog homologa C) konjugacije homolognih kromosoma D) spiralizacije kromosoma E) nestajanja jezgrine ovojnice 331. Koji od navedenih genotipova može biti iz P (parentalne ili roditeljske) generacije? A) Aabb B) AABb C) AAbb D) aaBb E) AaBB 329. Koje nasljeđivanje nazivamo spolno vezanim? A) koje je vezano za jedan spol B) nasljeđivanje gena na X kromosomu C) nasljeđivanje gena na Y kromosomu D) nasljeđivanje gena na spolnim kromosomima E) svi su odgovori točni 325. Koji je haploidan broj kromosoma u vinske mušice? A) 1 B) 2 C) 3 D) 4 E) 5 327.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 333. Za oksidaciju i redukciju molekula je značajno: A) oksidacijom se gube elektroni B) oksidacijom se prihvaćaju elektroni C) redukcijom se gube elektroni D) ishodište su im anoganski spojevi E) niti jedan odgovor nije točan 335. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatsku mrežicu 190 . riboza i trifosfat 334. U koži se nalaze: A) opipna tjelešca B) živčani ogranci C) žlijezde lojnice D) masne stanice E) svi su odgovori točni 341. Najtočniji odgovor za ATP je sljedeći: A) adenin i trifosfat B) adenozin i monofosfat C) adenozin i difosfat D) AMP+P E) adenin. DNK se nalazi u: A) kromosomima B) kloroplastima C) mitohondrijima D) bakterijama E) svi su odgovori točni 337. Jezgrica nema: A) bjelančevina B) rRNK C) DNK D) ribosomskih podjedinica E) ovojnice (membrane) 338. Blastoporus je: A) otvor na embrioblastu B) otvor na trofoblastu C) otvor na gastruli žabe D) šupljina blastule E) šupljina gastrule 343. Kromosomi se nalaze u središtu stanice u: A) profazi B) metafazi C) anafazi D) telofazi E) mejozi 339. Neuron je: A) neurit B) akson C) dendrit D) živčana stanica E) živac 340. Fagocitoza spada u: A) enzimske reakcije B) endocitozu C) električni potencijal stanične membrane D) aktivni prijenos iona E) pasivni prijenos 336. Od mezoderma se razvijaju: A) sluznica probavila B) jetra C) gušterača D) mišići E) pluća 344. Blastoderm je sloj stanica koji okružuje: A) embrioblast B) trofoblast C) blastocel D) celom E) pracrijevo 342.

u anafazi I mejoze: A) nastaju 2 nove jezgre 191 . Koji od spomenutih organizama spadaju u prokarite: A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge 346. Za jezgricu je značajno: A) nije obavijena opnom B) ima RNK C) ima DNK D) sintetizira rRNK E) svi su odgovori točni 356. Drugi Mendelov zakon nasljeđivanja je primjenjen u: A) svakom križanju B) intermedijarnom križanju C) monohibridnom križanju D) slobodnoj i nezavisnoj kombinaciji E) križanju s vezanim genima 348. Slijed baza UUU odgovara sljedećoj aminokiselini: A) tirozinu B) serinu C) fenilalaninu D) asparginu E) metioninu 352. Mitohondriji su organele: A) samo životinjskih stanica B) samo biljnih stanica C) važne za sintezu proteina D) važne za sintezu nukleinskih kiselina E) važne kao energetske centrale 355. Kromatin se nalazi u: A) profazi B) metafazi C) anafazi D) interfazi E) telofazi 357. Koji je odgovarajući antikodon na tRNK? A) GAC-UAG B) GTC-TAG C) CAC-UAC D) GAG-TAC E) GUC-UAC 353. Koja gameta pripada genotipu AaBb? A) A B) a C) B D) b E) Ab 350. Lizosomi: A) obavijeni su dvostrukom opnom B) nemaju membrane C) sadrže enzime D) sadrže mitohondrije E) niti jedan odgovor nije točan 354. Test križanje je sljedeće: A) aaBb x Aabb B) aaBB x AAbb C) AaBb x AaBb D) aabb x AABB E) AaBb x AABB 349. Morgan je nazvao crossing-overom: A) razmjenu dijelova kromosoma i gena B) razdvajanje homolognih kromosoma C) razdvajanje kromatida pojedinih kromosoma D) pojavu kod nevezanih gena E) niti jedan odgovor nije točan 351. Koja od spomenutih zigota nije homozigota? A) aaBB B) AAbb C) aabb D) AABB E) AaBb 347._________________________________________________________________________ Pitanja 345. Kodon na gRNK je CUG-AUC.

Žlijezde s unutrašnjim izlučivanjem su: A) hipofiza B) štitnjača C) nusštitne žlijezde D) nadbubrežne žlijezde E) svi su odgovori točni 192 . Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) nijedan odgovor nije točan 368. Tilakoide i grana pripadaju: A) vakuolama biljnih stanica B) mitohondrijima C) kloroplastima D) kromosomima E) centrosomima 366. Nukleoid je: A) spolni kromatin B) jezgra biljnih stanica C) DNK u jednostaničnim organizmima D) organela u citoplazmi E) DNK u bakterija 365. Nije točno da od ektoderma nastaju: A) koža B) osjetila C) živčani sustav D) epitel E) hrskavica 361.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) nastaje haploidan broj kromosoma C) odvajaju se homologni kromosomi D) odvajaju se kromatide E) kromosomi se ne vide 358. U biologiju spada: A) fiziologija B) taksonomija C) paleontologija D) zoologija E) svi su odgovori točni 367. Spermatogeneza i oogeneza odgovaraju: A) diobi citoplazme B) mejotičkoj diobi C) mitotičkoj diobi D) diobi kromosoma E) niti jedan odgovor nije točan 359. Geni A i b nalaze se na različitim mjestima istog kromosoma pa govorimo o: A) monohibridnom nasljeđivanju B) intermedijarnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanom nasljeđivanju 363. nalazimo u: A) telofazi I B) interfazi C) profazi D) metafazi I E) telofazi II 360. svaki sa svoje dvije kromatide. Haploidan broj kromosoma. Omjer genotipova i fenotipova 1:1 dobijamo križanjem roditelja: A) Bb x bb B) Bb x Bb C) Bb x BB D) BB x bb E) bb x bb 364. Koji od navedenih roditeljskih parova daje potomstvo u omjeru fenotipova 3:1 za jedno od spomenutih svojstava: A) AaBb x AAbb B) AaBb x aaBB C) AaBb x aabb D) AABB x aabb E) AaBB x Aabb 362.

Trofoblast je sloj stanica koji: A) okružuje zigotu B) okružuje gastrulu C) okružuje embrioblast D) se razvija u amnion E) se razvija u alantois 374. Na polovima diobenog vretena nalaze se: A) ribosomi B) lizosomi C) centrosomi D) Golgijeva tijela E) nukleoidi 378. Koji su genotipovi roditelja? A) aabB x AABb B) AABB x aabb C) AaBb x AaBb D) AaBB x AABb E) AaBb x aabb 376. Životinjski virusi imaju od genetskog materijala: A) samo DNK B) RNK ili DNK C) samo RNK D) proteine E) polisaharide 375. U profazi I mejotičke diobe odvija se: A) smještaj kromosoma u sredini stanice B) konjugacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) isto kao u mitozi 370. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2 193 . Ektoderm nastaje: A) u unutrašnjosti gastrule B) na površini gastrule C) na animalnom polu gastrule D) oko blastocela E) oko arhenterona 373. Nakupine hidrolitičkih enzima nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima 380. Nasljeđivanje vezano za spol prenosi se: A) izravno s oca na sina B) izravno s oca na kći C) s majke samo na sina D) s majke samo na kći E) na potomstvo jednako s oca i majke 377. Hrapavi endoplazmatski retikulum najviše je razvijen u stanicama: A) embrionalnim B) tumora C) koje sintetiziraju mnogo bjelančevina D) živčanim E) koje sintetiziraju mnogo ugljikohidrata 379. Rezultat križanja je omjer fenotipova 9:3:3:1._________________________________________________________________________ Pitanja 369. Blastoderm je sloj embrionalnih stanica koji se nalazi: A) oko blastoporusa B) oko blastocela C) na vegetativnom polu blastule D) oko trofoblasta E) oko embrioblasta 371. Blastoporus je otvor koji vodi u: A) arhenteron B) blastocel C) sekundarnu tjelesnu šupljinu D) amnionsku tekućinu E) blastocistu 372.

Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi B) fitofagi C) zoofagi D) heterofagi E) autotrofi 389. Oksidacijski proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitka elektrona D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima 382. Periodičke sezonske promjene organizama zovu se: A) sukcesije B) fenološke pojave C) biotičke pojave D) ekološke valencije E) vegetativne promjene 387. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje 384. Prostor na kojemu je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem 388. Do oplodnje jajne stanice sisavaca dolazi u: A) vagini B) maternici C) jajovodu D) trbušnoj šupljini E) jajniku 383. Važni razlagači u ekosistemima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 386. Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) dušikovih bakterija 390. Koji je ekosustav najproduktivniji u proizvodnji organskog ugljika? A) stepa B) obrađena površina C) šuma D) jezero s tvrdom vodom E) jezero s mekom vodom 392. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopladno drveće C) travnjaci D) papratnjače E) mahovine i lišajevi 385.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) fermentacija ili vrenje E) Krebsov ciklus 381. Najstariji ostaci prvih hominida pripadaju: A) australopitekusu B) ramapitekusu C) neandertalcu 194 . Vrsta ograničena na uže područje je: A) relikt B) endem C) plankton D) nekton E) rudiment 391.

Mutacije gena su uvijek: A) spontane mutacije B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 399. Trajnu promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 404. Trajne oblike bakterija zovemo: A) prokariot B) nukleoid C) spora D) viroid E) prion 402. Dječja paraliza (polio) uzrokovana je: A) virusom B) bakterijom C) kokima D) bacilima E) spirilima 401. U sastav kože ne ulaze stanice: A) žlijezda znojnica B) žlijezda lojnica C) dlake D) masnog tkiva E) Bowmanove čahure 400. Antropologija pručava ponajprije: A) antropomorfne majmune B) australopitekusa C) neandertalce 195 . Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) “miješanje” očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip 398. Biološki indikatori zagađenja okoliša su: A) virusi i bakterije B) bakterije i modrozelene alge C) bičaši i zelene alge D) gljive i mahovine E) lišajevi i borovi 394. Kuga (crna smrt) uzrokovana je: A) bakterijom B) virusom C) viroidom D) prionom E) bakteriofagom 403. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300 m D) 400 m E) 450 m 395. Bakteriofagi pripadaju: A) biljnim virusima B) primitivnim jednostaničnim biljkama C) primitivnim jednostaničnim životinjama D) pneumokokima E) ni jednoj navedenoj skupini 396._________________________________________________________________________ Pitanja D) javanskom pračovjeku E) krapinskom pračovjeku 393. Escherichia coli: A) koristi se u genetskom inženjerstvu B) može proizvoditi inzulin C) je crijevna bakterija D) može se naći u mokraći E) svi su odgovori točni 397.

Cricka D) J. Pojam genetička karta potječe iz znanstvenog rada: A) G. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatski retikulum 409. Kultura stanica i tkiva: A) su izolirane stanice i tkiva uzgajane u strerilnim uvjetima B) su stanice i tkiva uzgajane izvan organizma C) je rast stanica i tkiva na posebnim hranilištima D) je uzgoj stanica i tkiva u različitim eksperimentalnim uvjetima E) svi su odgovori točni 407. Watsona E) A. Humana genetika raspoređuje gene čovjeka u genetičke karte.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) pračovjeka Homo erectus E) čovjeka 405. Populacija različitih biljnih i životinjskih vrsta čine složeniju cjelinu: A) biomasu B) biocenozu C) biocenologiju D) biotop E) biosferu 413. Mendela B) T. Hersheya 406. Na dnu hranidbene piramide nalaze se: A) konzumenti B) fitofagi C) zoofagi D) karnivora E) autotrofni proizvođači 196 . Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) olakšana difuzija 412. Koji od spomenutih organizama spadaju u prokariote? A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge 410. Morgana C) F. Životinjski virusi se razmnožavaju: A) konjugacijom B) diobom C) pomoću DNA D) pomoću RNA ili DNA E) cijepanjem 408. Dvostruku membranu imaju: A) ribosomi B) lizosomi C) centrioli D) Golgijevo tijelo E) mitohondriji 411. Biljojedi kao članovi ishrane svake biocenoze spadaju u: A) razlagače B) autotrofne organizma C) heterotrofne organizme D) saprofage E) karnivore 414. Najznačajniju sekundarnu organsku produkciju ostvaruju: A) virusi B) bakterije C) protisti D) biljke E) životinje 415.

Plazma je dakle prema urinu: A) atonična 197 . Limfa se razlikuje od krvi po tome što nema: A) plazme B) leukocite C) trombocite D) eritrocite E) krvne pločice 421. Među stanicama odrasla čovjeka ne dijele se: A) spermatogonije B) neuroni C) oogonije D) primarne spermatocite E) sekundarne spermatocite 423._________________________________________________________________________ Pitanja E) trbušnu šupljinu 416. U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme. Mitohondriji: A) su energetske centrale stanica B) su glavni proizvođači ATP C) imaju dvostruku ovojnicu D) sadrže DNA E) sve su prethodne tvrdnje točne 420. Koje su bakterije uzročnici upale pluća? A) streptokoki B) spirili C) stafilokoki D) diplokoki E) vibrioni 418. U ishrani biocenoze na prvom su mjestu hranidbenog lanca: A) saprofagi B) heterotrofne bakterije C) autotrofni proizvođači D) fitofagi E) zoofagi 417. Urin je dakle prema plazmi: A) izotoničan B) monotoničan C) hipertoničan D) hipotoničan E) hipertrofičan 424. Porast ljudske populacije određen je: A) natalitetom B) morbiditetom C) genskom snagom D) biološkim faktorima (isključivo) E) fizičkim faktorima (isključivo) 425. U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme. Oplođeno jaje sisavca implantira se u: A) sluznicu maternice B) tijelo maaternice C) sluznicu jajovoda D) cerviks uterusa 422. Opseg prostorne rasprostranjenosti ljudske vrste zovemo njegovim: A) biomom B) ekosistemom C) biocenozom D) arealom E) biotopom 426. Tuberkulozu i šarlah uzrokuju: A) amebe B) protoza C) fagi D) virusi E) bakterije 427. Stanično disanje: A) nazivamo respiracijom B) razgradnjom ugljikohidrata oslobađa energiju C) počinje glikolizom D) nastavlja se Krebsovim ciklusom E) sve su prethodne tvrdnje točne 419.

Jezgre nemaju: A) primitivne životnjske stanice B) neuroni C) stanice glatkog mišića D) eritrociti sisavaca E) poprečno prugasti mišić 434. U heterotrofne organizme ne spadaju: A) alge B) gljive C) člankonošci D) spužve E) jednostanične životinje 435. Virusi mogu uzrokovati: A) tuberkulozu B) aterosklerozu C) dječju paralizu D) sifilis E) tetanus 437. Prema načinu ishrane bakterije mogu biti: A) autotrofne 198 . Ekosustav čine: A) ekološka valencija B) biotop i biocenoza zajedno C) populacija D) abiotički učinci E) biotički učinci 432. Rasprostranjenost većine ljudse populacije na Zemlji ovisi o: A) vegetaciji tog područja B) bentoskim biocenozama C) planktonu D) nektonu E) reliktima 429. Posebni zoološki rezervat je: A) otok Mljet B) Risnjak C) Plitvička jezera D) Ćorkova uvala E) Kopački rit 436. Koje tvrdnje odgovaraju krapinskog pračovjeka? A) potječe iz pleistocena B) kromanjonac C) visine do 160 cm D) satar 300 – 500 000 godina E) ima izraženu bradu opisu 433. Bakteriofagi su sastavljeni od: A) citoplazme i membrane B) jezgre i ovojnice C) mitohondrija i proteina D) glavice i repa E) prokariontskih stanica 438. Koki su: A) virusi B) bakterije C) eukariotske stanice D) animalne stanice E) štapićastog oblika 439. Krapinski pračovjek: A) živio je prije milijun godina B) imao je istaknutu bradu C) poznavao je vatru D) pripadao je tipu kromanjonca E) pripadao je tipu australopitekusa 431.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) monotonična C) hipertonična D) hipotonična E) izotonična 428. Bentosku biocenozu čine: A) životinje koje se pomoću mišića brzo kreću u vodi B) svi organizmi koji žive u vodi stajaćici C) svi organizmi koji žive uz morsku obalu D) organizmi koji žive na morskom dnu E) organizmi koji lebde u slojevima morske vode 430.

do 14. do 14. Eukariontske stanice uključuju: A) koke B) bacile C) vibrione D) sve bakterijske stanice E) biljne stanice 441.G. dana D) visokim LTH od 1. Endocitoza je pojava vezana uz sljedeće organele u stanici: A) mitohondrije B) lizosome C) jezgricu D) ribosome E) endoplazmatsku mrežicu 442. Iz srednjeg kvartara – pleistocena – potječe A) kromanjonski čovjek B) neandertalski pračovjek C) australopitekus D) driopitekus E) propliopitekus 446. Bujnost života na kopnu ovisna je uglavnom o: A) biotičkim faktorima B) svim abiotičkim faktorima C) povoljnoj temperaturi D) raspoloživosti dušika E) raspoloživosti ugljika 450. Darwina 451. Najveće količine kisika u atmosferi potrebnog za disanje potječu: A) od vulkanske aktivnosti B) od aktivnosti razlagača C) od fotosintetske aktivnosti D) od nektona E) od bentosa 449. Krambergera E) zahvaljujemo radu Ch. dana 445. Modifikacije: A) spadaju u mutacije B) su mutacije građe kromosoma C) su mutacije gena D) su nasljedne E) nisu nasljedne 199 . Znanstveno ime (binarna nomenklatura) suvremenog čovjeka: A) glasi Hominidae B) glasi Homo erectus C) glasi Homo sapiens D) zahvaljujemo radu D._________________________________________________________________________ Pitanja B) mesojedi C) biljojedi D) zoofagi E) fitofagi 440. Vitamin D: A) spada u skupinu ugljikohidrata B) spada u skupinu nukleinskih kiselina C) važan je za razvitak crvrenih i bijelih krvnih stanica D) važan je za razvitak kostiju i zubi E) važan je za razvitak spolnih žlijezda 443. Menstrualni ciklus karakteriziran je: A) visokim progesteronom u preovulacijskoj fazi B) visokim progesteronom u postovulacijskoj fazi C) visokim progesteronom od 1. Biljni virusi: A) razaraju biljnu stijenku B) svi se prenose kukcima C) genetski materijal je RNA D) slični su bakterijskim virusima E) razmnožavaju se diobom 448. Među “živim fosilima” su poznati: A) ihtiostega B) kinesko drvo ginkgo C) mamut D) praptica E) pteridosperme 447. dana E) visokim LH od 1. do 28.

Točna tvrdnja je A) dvosupnice imaju čupavo korijenje B) stabljika dvosupnica raste u debljinu pomoću kambija C) glavne žile u listu jednosupnica su razgranjene D) glavne žile u listu dvosupnica su usporedne 462. U razvojnom putu mahovine spolna generacija su A) protonema s mahovinom B) mahovina sa sporangijem C) sporogon D) protalij 459. Saprofiti su organizmi koji A) obitavaju u drugim organizmima B) se razmnožavaju samo pomoću spora C) žive na štetu domadara D) upijaju hranu iz mrtvih organizama 455.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 452. Prijelazni oblici između vodozemaca i gmazova su: A) štitoglavci (Seymouria) B) resoperke (Crossoptergia) C) zvijerogušteri (Theriodontia) D) gmaz Ichtiosaurus 463. Lišaj je osobit oblik simbioze između A) gljive i alge B) gljive i bakterije C) alge i bakterije D) bakterije i korijena lepirnjača 458. Rudimentarni organ nije: A) crvuljak slijepog crijeva B) trtica C) palčana kost D) zub mudrost 465. Homologni organi su: A) isti po funkciji. Sorusi su A) muški spolni organ mahovine B) nakupine sporangija na listu paprati C) diploidna generacija mahovina D) stabalce mahovine s muškim rasplodnim organima 460. Amiloplasti su A) leukoplasti koji sadrže škrob B) proplastidi koji sadrže proteine C) kloroplasti koji sadrže škrob D) leukoplasti koji sadrže aminokiseline 457. a različitog postanka B) istog postanka. a različiti po funkciji C) istog postanka i istih funkcija D) različitog postanka i različitih funkcija 464. Endocitoza je A) aktivan prijenos kroz membranu B) stanično “proždiranje” velikih čestica C) unošenje molekula direktno u citosol D) unošenje iona u stanicu 456. Koji od pojmova su krivo spareni? A) bakterija – nukleoid B) protocita – organeli C) eucita – jezgra D) eucita – citoskelet 454. Uobičajeni predstavnici planktona su: A) algašice B) bentonski organizmi C) bičaši i kremenjašice D) zelene alge 466. Plazmidi su: A) specifični virusi B) vrste mikroorganizama C) hibridne molekule DNA D) hibridne molekule RNA E) male čestice DNA 453. Kod alga kremenjašica kao produkt asimilacije nastaje: 200 . Makrosporangij odgovara A) plodnom listu B) zametnoj vrećici C) sjemenom zametku D) mikrospori 461.

molekule. stanica. populacija. organizam. organizam. Steljka je: A) rasplodni organ alge B) tijelo alge C) mala stabljika D) embrionalni organ biljke 468. makromolekule. organizam. makromolekule. Sve biljne zajednice nekog područja čine A) floru B) vegetaciju C) biocenozu D) biotop 474. atomi E) biocenoza. Svjetlosnim mikroskopom ne vidimo: A) pseudopodije amebe B) staničnu jezgru C) plastide D) trepetljike papučice E) uzročnika herpesa 477. Plod komušku imaju A) žabnjaci B) ruže C) lepirnjače D) krstašice 473. molekule. molekule. stanica. stanica. molekule. atomi 478. Protalij je A) razvojni stadij paprati B) razvojni stadij mahovina C) sporofit D) nespolna generacija 469. Predstavnici porodice ruža imaju A) cvjetove s peteročlanim ocvijećem i mnogo prašnika B) devet prašnika i plod mahunu C) četiri lapa i četiri latice D) cvijetove skupljene u rese 472. populacija. populacija. Točan redoslijed živih sustava u organizacijskoj ljestvici (od najvišeg prema najnižem) je: A) atomi. molekule. Ako se biljna stanica nalazi u hipertoničnoj otopini. makromolekule. populacija. ekosustav D) ekosustav. stanica. ekosustav C) atomi. dolazi do: A) osmoze 201 . makromolekule. Autosomi su A) svi kromosomi nekog organizma B) spolni kromosomi C) svi kromosomi nekog organizma osim x i y kromosoma D) samo kromosimi vinske mušice 475. organizam. Smatramo da su se sjemenjače (cvijetnjače) razvile od: A) vodenih biljka koje su prešle na kopno B) mnogostaničnih alga C) cikadina D) izumrlih heterospornih papratnjača 470. Koji od pojmova su krivo spareni? A) plodni list – listić s makrosporangijem B) sjemeni zametak – makrosporangij C) peludovo zrno – mikrospora D) peludnica – makrosporangij 471. biocenoza. ekosustav._________________________________________________________________________ Pitanja A) škrob B) bjelančevine C) ulje D) kremen 467. makromolekule. Centromera je A) mjesto na kromosomu za koje se vežu ili diobenog vretena B) sekundarno suženje kromosoma C) satelitski kromosom D) dio centrosoma 476. populacija. organizam. stanica. biocenoza. ekosustav B) atomi. biocenoza.

Koja od navedenih biljaka pripada porodici trava? A) vladac B) bijeli luk C) riža D) preslica E) divlji kupus 485. Prve kopnene zelene biljke bile su A) mahovine B) psilofiti C) pteridosperme D) lišaji E) papratnjače 483. Iz oplođene jajne stanice u kritosjemenjača razvija se: A) sekundarni endosperm B) embrionska vreća C) klica 202 . Florni elementi nekog područja su: A) biljke rasprostranjene samo u nekom većem području i značajne za floru tog područja B) sve biljne vrste nekog područja bez obzira na površinu koju pokrivaju C) biljne zajednice nekog područja D) biljke kojima je areal ograničen na usko područje E) svi odgovori su točni 487. a to znači da: A) sve tjelesne stanice žene imaju po jedan x kromosom B) sve tjelesne stanice muškarca imaju po jedan y kromosom C) 50 % spermija sadrži x kromosom D) 50 % jajnih stanica sadrži x kromosom E) svi spermiji imaju y kromosom 489. Ulogu korijena kod mahovina vrši: A) protonema B) hifa C) rizom D) rizoid E) grebenica 486. “Crossing-over” se događa u mejozi za vrijeme: A) profaze I B) anafaze I C) interfaze D) profaze II E) telofaze II 488. Spolna generacija kod papratnjača A) razvijenija je od sporofita B) protalij je diploidan C) na protaliju se nalazi arhegonij i antreridij D) je sorus E) spermatozoidi nastaju u arhegoniju 480. Spol čovjeka određuju spolni kromosomi x i y. a nemaju plod D) od sjemenog zametka nastaje plod E) za razmnožavanje im je potrebna voda 481.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) plazmolize C) dijalize D) deplazmolize E) difuzije 479. U izgradnji sedrenih naslaga na jezerima sudjeluju: A) lišaji i gljive B) dvosupnice i jednosupnice C) paprati D) alge kremenjašice E) modrozelene alge i mahovine 482. Reliktni endem je: A) krški runolist B) degenija C) ilirska perunika D) dubrovačka zečina E) hrvatska sibireja 484. Za kritosjemenjače je karakteristično: A) sjemeni zameci smješteni su otovreno na plodnim listovima B) sjemeni zameci su zatvoreni u plodnici C) imaju plodnicu.

Rast biljke u debljinu ostvaruje se diobom stanica A) epiderme B) parenhima C) felogena D) floema E) kambija 493. Fototropno svijanje klice uzrokovano je: A) djelovanjem sile teže 203 . Uzročnici biljnih bolesti. Katabolizam je: A) podražaj koji izaziva osjet boli B) reakcija u kojoj se oslobađaju kationi C) razgradnja većih molekula u manje jedinice D) sinonim za stanično disanje E) sintetički proces 501. Svjetlosna energija apsorbirana tijekom fotosinteze pohranjuje se u: A) klorofilu B) karotenoidima C) ATP i ugljikohidratima D) NADPH2 E) vodi 500. RNA može biti izvor genetičkih informacija kod: A) mikoplazma B) priona C) bakterija D) virusa E) alga 494. Ostatke kukovlja u kita ubrajamo u: A) atavizme B) zakržaljale rudimentarne organe C) prijelazne oblike D) prilagodbe na život u vodi E) ništa od navedenog nije točno 491. građeni su od: A) proteina B) RNA i proteina C) RNA D) DNA E) DNA i proteina 495. nekad RNA D) samo dvolančanu RNA E) samo RNA 497. Vegetacija je: A) popis životinjskih vrsta nekog područja B) skup biljnih zajednica nekog područja C) popis biljnih vrsta nekog područja D) skup endemičnih biljaka nekog područja E) flora i fauna nekog područja 498. Najvažniji činilac u postanku vrsta je: A) genska snaga B) mutacija C) divergencija D) prekobrojno potomstvo E) varijabilnost 492._________________________________________________________________________ Pitanja D) peludna mješinica E) plodnica 490. Organel prisutan u animalnoj stanici. a nije zastupljen u biljnoj stanici je: A) jezgrica B) centriol C) vakuola D) mitohondrij E) kloroplast 499. viroidi. Bakterije sadrže: A) DNA i RNA B) samo DNA C) nekad DNA. Najjednostavniji virusi izgrađeni su od: A) lipida B) proteina i nukleinske kiseline C) proteina i masti D) lipida i organskih kationa E) lipida i nukleinskih kiselina 496.

Bulbili su: A) rasplodni pupovi B) spore gljiva C) mlade lukovice D) organeli u biljnim stanicama E) vrste gomolja 505. Zaštićene vrste našeg područja su: A) vidra B) podbjel C) potajnica D) obična kockavica E) bizamski štakor 512. Koacervatne kapljice su: A) koloidne kapljice s opnom koje nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli B) agregati aminokiselina nastali suhim zagrijavanjem C) prve žive stanice D) kapljice lipida i proteina E) koloidne kapljice s čvrstom membranom Pitanja s dva točna odgovora 509. Koje se od navedenih tvrdnji odnose na populaciju? A) sastoji se od jedinki različitih vrsta koje naseljavaju isto područje 204 . Centri za regulaciju tjelesne temperature nalaze se u: A) termoreceptorima kože B) hipotaalamusu C) stijenkama krvnih žila D) kori velikog mozga E) štitnjači 508. Kriptorhizam je: A) prilagodba biljaka na hladna staništa B) razvoj adventivnog korjenja u kritosjemenjača C) zadržavanje sjemenika u trbušnoj šupljini D) vrsta hemofilije E) suženje porođajnog kanala 504. Od polisaharida u životinjskim organizmima dolazi: A) škrob B) fruktoza C) glukoza D) glikogen E) laktoza 506. Pubertet započinje lučenjem neurosekretornih tvari i hormona u: A) štitnjači B) hipotalamusu C) adenohipofizi D) nadbubrežnoj žlijezdi E) neurohipofizi 507.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) razlikama u sadržaju škroba između gornjeg i donjeg dijela C) prejakim osvjetljavanjem D) promjenom turgora na osvjetljenoj strani E) razlikama u sadržaju hormona između osvjetljene i zasjenjene strane 502. Nitrifikacijske bakterije su kemosintetske bakterije koje: A) razgrađuju organske spojeve uginulih organizama B) su uzročnici brojnih bolesti C) dobivaju energiju oksidacijom organskih spojeva D) oksidiraju amonijak u nitrit E) vežu dušik iz zraka 503. Olistala biljka paprati je: A) diploidna generacija B) haploidna generacija C) gametofit D) sporofit E) sporangij 510.

višestanične životinje razvile su se iz: A) bičaša B) volvoksa C) organizma koji se razvio udruživanjem većeg broja jednostaničnih bičaša D) trepetljikaša 517. Brzinu reakcije u stanici reguliraju sljedeći spojevi: A) ugljikovodici B) enzimi C) ugljikohidrati D) masti E) hormoni Pitanja s jednim točnim odgovorom 515. U ljudskom organizmu prvo se počmu probavljati: A) masti B) proteini C) škrob D) fosfolipidi E) nukleinske kiseline F) celuloza 522. Ciklus limunske kiseline ili Krebsov ciklus je: A) prva faza disanja koja se odvija u citoplazmi B) proces u kojemu se iz 1 mola glukoze oslobodi energija 1254 kJ 205 . Najproduktivniji ekosistem je: A) obradivo tlo B) listopadne šume C) jezero D) zapadni Atlantik 516. Od navedenih endokrinih žlijezda samo su dvije s unutarnjim i vanjskim izlučivanjem A) gušterača B) štitna žlijezda C) spolna žlijezda D) nadbubrežna žlijezda E) hipofiza 514. Voda koju izlučujemo u mokraći potječe od: A) tekućine koju pijemo B) hrane koju jedemo C) metaboličkih procesa D) A+B E) A+B+C 521. Pomoću albumina u krvi se može transportirati: A) željezo B) tiroksin C) vitamin C D) fibrin E) holesterol 519. Koja je od navedenih stanica agranularni leukocit? A) monocit B) trombocit C) eozinofil D) neutrofil E) bazofil 518. Probavne enzime ne izlučuje: A) želudac B) taanko crijevo C) jetra D) gušterača 520._________________________________________________________________________ Pitanja B) sastoji se od jedinki iste vrste koje su prostorno izolirane C) sastoji se od jedinki iste vrste koje nadeljavaju određeni prostor D) skup jedinki povezanih prehrambenim lancima E) skup jedinki čija je genetska osnova zajednička i u stalnoj je međusobnoj razmjeni 513. Prema Haeckelovoj hipotezi o podrijetlu (metazoa) višestaničnih organizama.

Koje su od navedenih tvrdnji točne: A) najslabiju moć regeneracije imaju primitivne životinje B) najslabiju moć regeneracije imaju odvedene životinje C) sposobnost regeneracije je manja u životinja na višem stupnju razvoja D) sposobnost regeneracije je manja u životinja na nižem stupnju razvoja 528. Genetska snaga ili genetska slučajnost: A) dolazi do izražaja u malim populacijama B) dominantni geni se brže šire C) recesivni geni se mogu izgubiti ili proširiti D) značajna je za veliki otvoren skup populacija 527. a na drugom kraju negativno nabijeni C) se povezuju s bjelančevinama koje ih pravilno orjentiraju D) su izgrađeni od ugljika. Homeotermni organizam je: A) morski ježinac B) aligator C) šaran D) šišmiš E) daždevnjak F) pingvin 531. Lipidi u biološkim membranama čine dvosloj zato jer: A) su to molekule dipolna karaktera kao i voda B) su na jednom kraju pozitivno. a drugi hidrofoban Pitanja s dva točna odgovora 524. Polumjesečasti zalisci nalaze se između: A) lijeve pretklijetke i klijetke 206 . Molekulu RNA čini različitom od molekule DNA: A) šećer riboza B) fosfat C) baza uracil D) baza timin E) ništa od navedenog nije točno 526. Zajedničko mahovinama i papratnjačama su: A) sporogoni B) spore C) anteridiji D) sorusi E) sorediji F) protaliji G) protoneme H) plazmodiji 530. kisika i fosfata E) je jedan kraj molekule hidrofilan. vodika. Većina vode koju biljka prima: A) cijepa se tijekom fotosinteze i služi kao izvor elektrona i vodika B) gubi se stomatalnom transpiracijom C) apsorbiraju stanice tijekom produžnog rasta D) ulazi u korijen iz tla osmozom E) ugrađuje se neposredno u organski materijal 525. U oligomeria spadaju: A) trp B) peripatus C) zmijača D) volak 529.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ C) dio aerobne respiracije u kojem se pirogrožđana kiselina razlaže u molekule ugljik(IV)-oksida i atome vodika D) dio anaerobne respiracije kojom se oslobađa 25 % energije pohranjeno u 1 molu glukoze E) proces koji oslobađa energiju iz produkata oksidativne fosforilacije 523.

Imela je poluparazit jer od svog domadara prima vodu s mineralnim tvarima pomoću __________. Uz ime biljke u gornjem stupcu upiši broj koji je napisan ispred dijela kojim se ta biljka vegetativno razmnožava. prodica žabnjaka 4. bulbil 537. ima vanjsku oplodnju 2. povaljenica 3. prije 30-40 tisuća godina 3. prodica krstašice 3. Populaciju čine jedinke iste vrste koje žive na istom prostoru i međusobno su povezane __________. 539. Uz pojmove u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je naveden odgovarajući opis! A) __ oogeneza B) __ spermalna stanica C) __ speramtogeneza D) __ gametogeneza 1. prije 500 tisuća godina Pitanja kojima treba upisati odgovore 538. A) __ kukurijek B) __ glog C) __ soja D) __ livadna kadulja E) __ uljana repica 1. Uz nazive životinja u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je napisan način razmnožavanja. prije 15 milijuna godina 2. stvaranje spolnih stanica 3. A) __ magnolija B) __ lukovičasta režuha C) __ perunika D) __ begonija 1. postanak jajnih stanica 534._________________________________________________________________________ Pitanja B) lijeve klijetke i aorte C) desne pretklijetke i klijetke D) desne klijetke i plućne arterije 532. Uz naziv čovjekovih predaka u gornjem stupcu upiši broj ispred navedenog vremena kada su živjeli. Fotosinteza je proces 207 . prodica usnjače 536. list 4. postanak spermija 2. ima nepotpunu preobrazbu 535. muška spolna stanica 4. Izlučivanje mlijeka prilikom dojenja potiče: A) estrogen B) prolaktin C) progesteron D) oksitocin Pitanja s povezivanjem odgovora 533. rizom 2. ima potpunu preobrazbu 3. Uz ime biljke u gornjem stupcu upiši broj koji je napisan uz naziv porodice kojoj određena biljka pripada. prodica ruža 2. Pitanja s jednim točnim odgovorom 540. prodica lepirnjača 5. koti žive mlade 4. A) __ kromanjonski čovjek B) __ ramapitekus C) __ australopitekus 1. A) __ tuljan B) __ skakavac C) __ šaran D) __ hrušt 1.

U molekuli crvenog pigmenta hemiglobina dolazi do vezanja A) kisika za žaljezo 208 . Glavonošci su najrazvijenija skupina mekušaca. odnosno 12 primarnih spermatocita razvit će se A) 48 sekundarnih spermatocita B) 24 spermatide i 48 spermija C) 48 spermija D) 12 spermija E) 24 sekundarne spermatocite F) 48 sekundarnih spermatocita 549. Koja od navedenih životinja je dvospolac i nema organa za disanje ni probavila ni krvotoka A) gujavica B) hobotnica C) hidra D) trakavica 542. Iz 12 spermatogonija. Koja je izjava o peludnom zrncu pogrešna? A) Peludna zrnaca nastaju u peludnicama. U uvjetima bez kisika kvasci dolaze do energije za životne procese A) vrenjem B) trulenjem C) eksplozivnim oslobađanjem toplinske energije D) ciklusom limunske kiseline E) kemosintetski 546. C) Prodor peludne mješinice u embrionsku vreću omogućuje oplodnju. Četverodjelno srce (dvije klijetke i dvije predklijetke) imaju sljedeće životinje: A) pastrva B) čovječje ribica C) krokodil D) grlica E) klokan F) stonoga 548. B) Mejozom se u peludnim zrncima razvija muški gametofit. D) Nakon oprašivanja vegetativna stanica razvija se u peludnu mješinicu. 543. Pri klijanju sjemenke pšenice u aleuronskom sloju pod utjecajem hormona događa se sljedeće: A) enzim amilaza razgrađuje škrob B) hormoni auksini i citokinini potiču diobu stanica C) enzimi proteaze razgrađuju pričuvne bjelančevine D) razgradnja aleuronskog sloja bakterijama uvjetuje klijanje Pitanja s dva ili više točnih odgovora 547. Kemosintetske bakterije dobivaju energiju za asimilaciju ugljik(IV)-oksida A) pomoću bakterioklorofila B) apsorpcijom UV-zraka C) apsorpcijom infracrvenih zraka D) oksidacijom organskih spojeva E) oksidacijom anorganskih spojeva 545. Koja se od navedenih osobina ne odnosi na glavonošce? A) imaju vrlo razvijen mozak B) građa oka im je slična kralješnjacima C) imaju razvijen krvožilni sustav D) dvospolci su 544.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ A) kojim označavamo sve kemijske sinteze na svjetlosti B) koji se zbiva u kromoplastima biljne stanice C) kojim se iz organskih tvari oslobađa kisik D) kojim se Sunčeva svjetlost pretvara u kvantume energije E) kojim se svjetlosna energija pretvara u kemijsku 541.

Pitanja s jednim točnim odgovorom 557. Otvaranje i zatvaranje puči na listu ovisi o sljedećim događajima: A) fotosintezi i porastu sadržaja šećera u svim epidermskim stanicama B) fotosintezi i porastu sadržaja šećera u stanicama zapornicama C) povišenju osmotskog tlaka u stanicama zapornicama D) ualženju vode u zapornice bubrenjem i kapilarnošću E) primanju vod etranspiracijom 553. genetičar i mikrobiolog pomagali su Juri 3. Koliko se sadnica može posaditi u ravan niz na zemljište dužine 80 m? __________._________________________________________________________________________ Pitanja B) ugljik(IV)-oksida za željezo C) kisika za bjelančevinasti (globinski) dio molekule D) kisika za željezo i bjelančevinasti (globinski) dio molekule E) ugljik(IV)-oksida bjelančevinasti (globinski) dio molekule 550. Ivo. Božo je __________. 1. U neprozirnoj vreći nalazi se 12 ružinih cvjetova. Četiri prijatelja biologa: mikrobiolog. a zoolog Juri Što su po specijalnosti Jura. Božo i Vlado pomagali su zologu 2. Božo. Partenogeneza je: A) stapanje spermija s jajnom stanicom B) razvoj jedinke iz neoplođene jajne stanice C) razvoj spolnog partnera 209 . ružičaste. Vlado je __________. Podražavanje receptorskog dijela neurona ima za posljedicu A) ulaženje kalija u stanicu B) ulaženje neurohormona u stanicu C) uspostavu pozitivnog električnog naboja u stanici D) oslobađanje neurohormona u međuneuronski prostor E) uspostavu negativnog električnog naboja u stanici F) oslobađanje auksina u međuneuronski prostor G) ulaženje natrija u stanicu Pitanja kojima treba upisati odgovor 554. genetičar i zoolog pomažu si u znanstvenom radu. Genetičar je pomagao Boži. Ivo je __________. 556. Koliko cvijetova treba izvaditi iz vreće da bi se sigurno izvadile najmanje dvije ruže jednake boje? _________. žute. Sadnice hrasta sade se na razmaku od 4 m. ljubičaste i narančaste boje. bijele. 555. Svaki prethodni član mesojed u hranidbenom lancu u pravilu je A) manji od sljedećeg B) veći od sljedećeg C) brojniji od sljedećeg D) ima manju ukupnu biomasu E) ima manju ukupnu energiju 552. Radom srčanog mišića usmjerava se A) venska krv iz desne klijetke plućnim arterijama u pluća B) arterijska krv iz pluća plućnom venom u lijevu pretklijetku C) venska krv iz desne klijetke plućnom venom u pluća D) arterijska krv iz pluća plućnim arterijama u lijevu pretklijetku E) venska krv iz tijela plućnom venom u desnu pretklijetku 551. Ivo i Vlado? Jura je __________. ekolog. od toga se po dva cvijeta crvene.

Osmometar A sadrži otopinu šećera koncentracije 1 mol/L. E) U svitkovce ubrajamo kopljaču i žiroglavce. Koji od navedenih organa ima ključnu ulogu u održavanju stalnog volumena tjelesnih tekućina? A) jetra B) slezena C) bubreg D) mišić 562. Koja je tvrdnja točna? A) Svi svitkovci imaju barem začetak pluća. Lišće zimi otpada A) boru B) arišu C) bukvi D) tisi E) omoriki 567. U posudi s vodom postavljena su dva osmometra. barem tijekom embrionalnog razvoja. Otrovne gljive su A) vrganj B) blagva C) pupavka D) rujnica E) muhara 566. Metodom antibiograma utvrđuje se: A) najdjelotvorniji antibiotik za ljiječenje virusnih infekcija B) nove lijekove protiv gripe C) nove lijekove protiv AIDS-a D) najdjelotvorniji antibiotik po najmanjoj zoni inhibicije rasta bakterija E) najdjelotvorniji antibiotik po najvećoj zoni inhibicije rasta bakterija 561. Sintezu i lučenje spolnih hormona induciraju: A) tireotropni hormon B) gonadotropni hormon C) ACTH 564. ali imaju kralježnicu.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) vanjska oplodnja E) unutarnja oplodnja 558. a B otopinu kuhinjske soli iste koncentracije. C) Plaštenjaci i svitkoglavci nemaju kralježnicu. Fosilni ostaci južnog pračovjeka (australopitekusa) nađeni su u: A) zapadnoj Australiji B) južnoj Aziji C) istočnoj i južnoj Africi D) južnoj Europi Pitanja s dva točna odgovora 565. B) Svi svitkovci imaju škržne pukotine na prednjem dijelu crijeva i svitak na leđnoj strani tijela. 210 . D) Plaštenjaci i svitkoglavci nemaju svitak. s oznakom A i B. Osmotski tlak A) jednak je u oba osmometra B) 4 puta viši je u A nego B C) 2 puta viši je u A nego B D) u A iznosi ½ vrijednosti tlaka u B E) u B iznosi ½ vrijednosti tlaka u A 560. Od tri metabolička segmenta razgradnje glukoze jedan je anaeroban: A) glikoliza B) Krebsov ciklus C) oksidativna fosforilacija 563. Probava bjelančevina (proteina) počinje u: A) ustima B) jednjaku C) želucu D) tankome crijevu 559.

Dormancija je A) bolest spavanja B) uzrokovana nedostatkom vitamina C C) nemogućnost klijanja sjemenke zbog nedostatka vlage D) razdoblje mirovanja kada sjemenka ne može proklijati E) bolest koju prenosi muha ce-ce F) nemogućnost klijanja sjemenke uzrokovana unutarnjim čimbenicima 573. Mjerilo gustoće populacija je: A) odnos između malađih i starijih članova populacije B) odnos spolova u populaciji C) broj jedinki neke vrste na određenom prostoru D) broj ženskih jedinki neke vrste u zajednici E) ukupna biomasa neke vrste na nekom prostoru 577. dušik iz zraka mogu vezati: A) nitrifikacijske bakterije B) denitrifikacijske bakterije C) dušikove bakterije D) patogene bakterije 211 . Koje od navedenih tvari nazivamo spolnim hormonima? A) tiroksin B) oksitocin C) adrenalin D) kortizol E) estrogen F) progesteron 571. Kljunaši i tobolčari: A) nesu jaja B) su aplacentalni sisavci C) nose mlade u tobolcu D) hrane mladunčad mlijekom koje se stvara u mliječnim žlijezdama majke E) su fosili F) su placentalni sisavci 574._________________________________________________________________________ Pitanja 568. U ciklusu kruženja dušika u biosferi. U procesu fotosinteze: A) dolazi do oksidacije CO2 B) toplina Sunca pobuđuje molekule klorofila C) se dio Sunčeve energije veže i pretvara u kemijsku energiju D) Sunčeva svjetlost oksidira NADPH2 E) Sunčeva svjetlost razlaže molekule vode F) sve sinteze ovise izravno o svjetlosti 572. U biocenozama saprofagi se harane: A) živim algama B) uginulim biljnim dijelovima C) bakterijama D) algama i bakterijama koje žive u moru E) životinjskim lešinama 575. Hormon inzulin: A) pospješuje ulazak glukoze u stanice B) olakšava izlazak glukoze iz stanica C) pospješuje sintezu glikogena u stanicama jetre D) pospješuje razgradnju glikogena (glikogenolizu) u stanicama 570. Među navedenim žlijezdama endokrine su: A) slinovnice B) hipofiza C) znojnice D) lojnice E) štitnjča F) jetra 569. Među nacionalne parkove Hrvatske ubrajamo: A) Malostonski zaljev B) otok Lokrum C) Risnjak D) Kopački rit E) otok Biševo s Modrom spiljom F) dio otoka Mljeta 576.

94×105 C) 3. Koliko najmanje miševa treba nasumce prebaciti u novi kavez ako se žele dobiti potomci? __________ 580. 18. __. Genetičar je planirao pokus te mu je zoolog dao 880 mušica. 8.8×106 586. Leđna moždina se nalazi A) ispod svitka B) iznad svitka C) unutar svitka D) ispod škržnog ždrijela 585. Za koliko je dana bilo zaraženo pola šume? _________ 581.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ E) modrozelene alge F) djetelina Pitanja s jednim točnim odgovorom 583. 37 B) 2. Za koliko je veći broj mušica kojima sada raspolaže genetičar od onog koji je preostao zoologu? __________ 579. 24. 10. __. od toga su polovica ženke. __ 212 . x(C) = 24 %. 5.94×106 B) 2. Gametofit je veći od sporofita kod: A) heterospornih papratnjača B) mahovina C) golosjemenjače ginka D) kritosjemenjača 584. Za sedam dana cijela šuma bila je zaražena. 32. x(A) = 35 %. U jednom polinukleotidnom lancu dvolančane molekule DNA brojevni udio pojedinih baza je: x(G) = 20 %. U pauka krstaša predljive žlijezde se otvaraju na A) helicerama (kliještima) B) nogama za hodanje C) stražnjem dijelu tijela D) žalcu 588. 20 minuta i 30 sekundi: A) 2. 8. U kavezu ima 20 miševa. 5. 12. x(T) = 21 %. 15. U proksimalnom (silaznom) tubulu bubrega resorbira se: Pitanja kojima treba upisati odgovore 578. Unutrašnju oplodnju imaju: A) svi kralješnjaci B) kukci C) ježinci D) meduze 587. Upiši brojeve koji nedostaju: A) 2. Gubari su napali šumu i svakim danom bilo je dvostruko više zaraženog drveća nego dan ranije. __ D) 2. __. 72 C) 0. 3. 3.9445×105 D) 3. Koliki je ukupni udarni volumen srca u mililitrima ako srce kuca 1 sat. to znači da je sastav drugog lanca sljedeći: x(G) __________ % x(A) __________ % x(C) __________ % x(T) __________ % 582.9445×106 E) 9. 17. Genetičar i zoolog imali su jednak broj vinskih mušica. U regulaciji koncentracije natrija putem bubreega sudjeluje: A) aldosteron B) antidiuretički hormon C) kortizon D) kortizol E) tiroksin 589.

vodeni beskralježnjaci. papratnjače. U kambriju su na Zemlji živjele A) bakterije. karakterizira: A) povećanje broja leukocita (leukemija) B) propadanje limfocita zbog umnažanja virusa u njima C) pojava oportunističkih infekcija D) virus ne pobuđuje nastajanje specifičnih protutijela 213 . papratnjače i vodeni beskralježnjaci B) bakterije. uzročnikom SIDE. CCA D) UAC. GGA. Kod navedenih hranidbenih lanaca u ekosustavima nije moguć: A) u moru planktonska alga – planktonski račić – punoglavac – skuša – morska mačka B) u jezeru planktonska alga – planktonski račić – riba ukljeva – riba pastrva – vidra C) u moru bakterije – školjkaš – hobotnica D) na kopnu trava – skakavac – zec – ris E) na kopnu biljni plodovi – šumski miš – kobac 597. alge i vodeni beskralježnjaci D) bakterije. U procesu glikolize od jedne molekule glukoze nastaju A) dvije molekule jabučne kiseline i 2 ATP-a B) četiri molekule jabučne kiseline i 4 ATP-a C) dvije molekule pirogrožđane kiseline i 2 ATP-a D) četiri molekule pirogrožđane kiseline i 2 ATP-a E) dvije molekule pirogrožđane kiseline i jedna molekula jabučne kiseline 594. ACU. GGU E) TAC. Ako je kod u genu za protein ATGGGATGACCA. GGA. Čovjek se može zaraziti trihinom ako A) jede neoprano voće i povrće onečišćeno zrelim jajima trihine B) pojede trihinom zaraženo meso C) pije vodu onečišćenu zrelim jajima trihine D) ga ubode trihinom zaraženi komarac 595. primitivne ribe i prvi kopneni kralješnjaci 591. Neurohormoni ili neurotransmiseri su spojevi koji se A) vežu za eksitacijske receptore neurona u kojem nastaju B) vežu za inhibicijske receptore neurona u kojem nastaju C) vežu za eksitacijske mjehuriće D) vežu na specifične receptore narednog neurona E) vežu na specifične receptore istog neurona 592. GGA. TGA._________________________________________________________________________ Pitanja A) ukupna količina fruktoze B) ukupna količina glukoze C) ukupna količina saharoze D) ukupna količina maltoze E) ukupna količina inulina 590. CCU. AUG B) AUG. vodeni beskralježnjaci i primitivne ribe C) bakterije. Hidatode su žlijezde za A) izlučivanje vodene pare B) izlučivanje vode C) izlučivanje sluzi D) primanje vode E) primanje sluzi 593. Infekciju virusom HIV. alge. UGA. CCU. UGA. CCA C) ATG. papratnjače. ACT. alge. onda pri sintezi proteina ribosomu redom pristupaju tRNA sa sljedećim antikodima: A) CCA. GGT Pitanja s dva točna odgovora 596. gljive. alge.

Organomotorna gibanja čiji je smjer neovisan o smjeru izvora podražaja i određen samo građom organa zovu se: __________. Dvije od navedenih bolesti uzrokovane su bakterijama: A) dječja paraliza B) bjesnoća C) mumps D) gripa E) encefalitis F) tuberkuloza G) sifilis 601.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ E) zaraza se ustanovljava samo elektronskim mikroskopom F) osobe bez simptoma bolesti nisu prenosioci virusa 598. 214 . Unos većih količina otpadnih razgradljivih organskih tvari u jezerski ekosustav izazvat će: A) bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima B) nedostatak kisika u pridnenim slojevima C) razvoj veće brojnosti vrsta s malim brojem jedinki D) smanjenje primarne organske proizvodnje E) smanjenje sekundarne organske proizvodnje 602. Kratkovidna žena crne kose. Najmanji uzročnici bolesti su __________ i __________. ima plave oči. Ako je vjero jatnost da njihovo dijete vidi normalno 1:4. 604. čija je majka normalnog vida. a boja kose i očiju određena je većim brojem gena. ima plavu kosu i smeđe oči. no možemo reći da su tamna kosa i smeđe oči dominantne osobine) __________. čiji je otac plavokos. Smreku prepoznajemo po sljedećim morfološkim karakteristikama: A) iglice su duge do 5 cm i drže se u parovima B) iglice su plosnate i tupe s dvije bijele usporedne pruge na donjoj strani C) iglice su četverouglaste i na vrhu šiljaste D) iglice su poredane okolo čitave grančice E) češeri stoje uspravno i ne otpadaju cijeli F) krošnja je nepravilnog oblika 599. Karakteristike bakterija su: A) razmnožavaju se sporama B) vide se samo elektronskim mikroskopom C) ne mogu se uzgajati na umjetnim hranjivim podlagama D) neke fotosintezom stvaraju organske spojeve E) iz zraka vežu kisik i njime obogaćuju tlo F) po organizaciji stanice pripadaju prokariotima Pitanja kojima treba upisati odgovore 603. 605. a ima vjerojatnost da ima smeđe oči 1:2. U karakteristike jednosupnica ubrajamo: A) čupavo krijenje B) žile u stabljici poredane u krugu C) peteročlani prsten D) rast u debljinu E) usporedne glavne žile u listu F) četveročlani cvijet 600. Kratkovidan muškarac. kolika je vjerojatnost da uz normalan vid i smeđe oči ima još i plavu kosu? (Napomena: kratkovidnost je dominantna osobina.

Bakterije se u povoljnim uvjetima razmnožavaju velikom brzinom. O kakvoj vrsti onečišćenja govorimo u tom slučaju? 215 . Koliko će bakterijskih stanica nastati od jedne bakterije nakon triju uzastopnih dioba? 607. E. Slika prikazuje molekulu kojoj nedostaje središnji element.4. B. A.1. 607. U vodi koju smo uzeli iz obližnjeg potoka otkrili smo prisutnost bakterije Escherichia coli.2. Kako se zove veza kojom se međusobno povezuju takve molekule? 606. Kakve su bakterije nastale diobom od jedne ishodišne? 607. Kako se naziva polimer sastavljen od mnogo takvih molekula? 607.4. C.1.2.Pitanja otvorenog tipa 606. 606.3. D. Na slici zaokruži slovo odgovarajućeg oblika ove bakterije. Bakterija Diplococcus pneumoniae uzrokuje upalu pluća. 607. Upišite na slici simbol kemijskog elementa koji nedostaje. 606. Kojoj skupini organskih spojeva pripada molekula na slici? 606.3.

prikazuju cvjetove i cvatove. Što je cvat? 608.4. Koja slika prikazuje zaštićenu biljku i kako se biljka zove? 608. do 7. 216 . 609. Slike od 4.1. Navedite četiri glavna dijela cvijeta. Slika prikazuje rodoslovno stablo svitkovaca. Cvat je prikazan na slici/slikama? 608. 608.2.3.608.

Iz kojih su se peraja vodenih kralježnjaka razvile noge kopnenih kralježnjaka? 609. Slika prikazuje shematski prikaz građe eukariotske stanice.2. Napišite imena glavnih skupina prikazanih svitkovaca. 610. 609.3. Zbog čega CO2 izlazi iz kapilarne krvi u alveole? 610. 217 .4. Slika prikazuje dišni sustav. 610. Navedite dvije zajedničke osobine svitkovaca.1. B i C 610.4.2.1. 609. Navedite dvije uloge dišnog epitela.609. 611. Imenujte dijelove dišnog sustava označene slovima A. Koji od svitkovaca prikazanih na slici imaju amnion i zašto? 610.3. Imenujte strukturu koja je na slici označena slovom D i navedite njezinu ulogu u disanju.

2. Navedite tri osobine koje su zajedničke mitohondrijima i plastidima. Koji tip stanice imaju bakterije? 612.4.1.4.3. Koji je organel na slici označen slovom A? Koja je njegova uloga? 611.2.3. Slika prikazuje građu plodišta gljiva. 612.1. 612.611. 612. Kako se zovu mjehurići koji sadrže probavne enzime i na kojem organelu nastaju? 611. 218 . Po čemu to zaključujete? Navedite jedan razlog. Prikazuje li slika životinjsku ili biljnu stanicu? Po čemu to zaključujete? 611. Kako se naziva genetički materijal bakterijske stanice koji je na slici označen slovom A? 612. Koja molekula čini genetički materijal bakterijske stanice? 613. Slika prikazuje bakteriju.

219 .4.4. Slika prikazuje list i detalj njegova presjeka. Kojoj skupini gljiva pripada plodište označeno slovom A. 615. Objasnite koja je uloga srčanih zalistaka. 614.2. 614. Slika prikazuje shematski prikaz građe srca. Koje gljivice proizvode antibiotike i koja je svrha primjene antibiotika? 614.1.2. a kojoj plodište označeno slovom B? 613. Koja srčana komora ima najdeblju mišićnu stijenku? Objasnite zašto? 614.613. Navedite dvije osobine gljiva po kojima su slične životinjama.1.3. 613. Objasnite kako se uznapredovala arteroskleroza odražava na vrijednosti krvnog tlaka. Zbog čega dolazi do „dizanja” tijesta pod utjecajem kvaščevih gljivica? 613.3. Koja je krvna žila označena na slici slovom A i koju krv provodi? 614.

4. Navedite dvije važne uloge puči.3. Koji organski spoj sudjeluje u izgradnji oklopa kukaca? 616. Slika prikazuje vinsku mušicu. gorko i kiselo.615.2. 615. Na slici označite strjelicama tri glavna dijela od kojih se sastoji tijelo kukca.2. 616. 220 . Po čemu se nepotpuna preobrazba kukaca razlikuje od potpune? 617. Na slici na prazne crte upišite okusna područja: slano.3. 616. Navedite prilagodbe u razmnožavanju kukaca za život na kopnu. Na svakoj strjelici napišite njegov naziv. Slika prikazuje ljudski jezik. 617.4. 616. slatko. Koje tvari provode žile lista? 616.1.1.1. prikazuje li slika list jednosupnice ili dvosupnice? Po čemu to zaključujete? 615. Kako se naziva tkivo lista koje se nalazi ispod gornje epiderme i koja mu je uloga? 615.

619.1. Koja je uloga glikolize u metabolizmu stanice? 619. 619. Koji se proces nastavlja na glikolizu u aerobnim uvjetima? 618. a koja molekula nastaje tim procesom? 618.3.4. 617.3.2. U nastavi biologije ispituju se svojstva škroba u različitim namirnicama. Kojoj skupini kralježnjaka jezik pomaže u „sakupljanju” mirisa? 618. Glikoliza je metabolički proces zajednički svim živim bićima. Zaokružite na slici osnovnu građevnu jedinicu škroba.617. U koju skupinu receptora pripadaju osjetilna tjelešca za okus? 617. Navedite još dvije uloge jezika osim osjetilne. Koji enzim iz sline razgrađuje škrob? 619. Navedite dvije namirnice u kojima smo mogli dokazati škrob. 618. Slika prikazuje stanicu euglene. Kako se naziva osnovna građevna jedinica škroba? 620.2.4. Koja je početna molekula u tom procesu. 221 .1. U kojem se dijelu stanice događa glikoliza? 618. 619.3.2.4.

Koje eukariotske stanice sadrže kloroplast? 222 . Koji je organel na slici označen slovom F? Koja je njegova uloga? 620.3. Objasnite koje je značenje prabičaša u tumačenju evolucije živoga svijeta. 621.3.4.1. 621. Koje je najvažnije krvotvorno tkivo čovjeka? 622.1.1.620. B. Koja je uloga tjelešaca označenih slovom D? 621. Koja su krvna tjelešca na slici označena slovom D? 621. Može li euglena živjeti bez stežljivog mjehurića (kontraktilne vakuole)? Objasnite zašto? 620.2. 622. Na slici slovima A. Koja krvna tjelešca odstupaju brojnošću ili strukturom kod osobe koja je anemična? 621. u čisto vodi ili u vodi opterećenoj organskim tvarima? Objasnite zašto? 620.4.2. Gdje je veća vjerojatnost za pronalazak euglene. Slika prikazuje kloroplast. C i D označeni su sastojci ljudske krvi.

623.3. 623. Kako se naziva dio kloroplasta označen slovom A? 622. Slika prikazuje stanicu u jednoj fazi mitoze. Koji se proces događa u kloroplastima? 622.2. razvili kloroplasti? 623.1. Što je kariotip? 623. 223 .622. Iz čega su se prema teoriji o endosimbiozi. Kako se naziva tvorba koja je na slici označena slovom A? Koja je njezina uloga u mitozi? 623.3.4. Jednom rečenicom objasni koja je uloga mitoze u živim bićima.4. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva.2.

624. Slika prikazuje pet carstava živih bića.3. Slika prikazuje promjenu broja bakterija u likvoru bolesnika.1. Proučite sliku i odgovorite na postavljena pitanja. Kako se naziva osnovna taksonomska (sistematska) kategorija? 624.624. 625.2. 624. Navedite po jednog predstavnika iz svakog prikazanog carstva. Kojim su slovom označeni prokariotski organizmi? 624. 224 .4. Navedite imena carstava sa slike. Bolesnik se liječio antibioticima.

1.4. Jednom rečenicom objasnite zašto mahunarke mogu rasti na tlu siromašnom dušikovim spojevima? 626. klamidomonas. Slika prikazuje šest predstavnika jedne skupine algi: volvoks. Dušik je značajan biogeni element.1.3. Koje dvije od prikazanih algi žive u planktonu kopnenih voda? 225 . jadranski klobučić.1. Kako se naziva proces koji na slici provode bakterije označene slovom A? 626.2. 627. kaulerpu. Slika prikazuje kruženje dušika u prirodi. Kako se zove znanstvenik koji je dokazao da su mikroorganizmi uzročnici zaraznih bolesti? 626.4. Kojim će se krvnim tjelešcima povećati brojnost nakon što je osoba zaražena bakterijama? 625.2. Navedite dvije biljke mesožderke. Navedite jednu organsku molekulu u koju se dušik ugrađuje. Kojeg je dana počeo djelovati antibiotik? 625. 626. 627. 625. dana. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u likvoru nakon 24. morsku salatu i spirogiru.3. 626.625.

627. Navedite jednu osobinu koja ukazuje na njihovo zajedničko podrijetlo. Slika prikazuje organe kritosjemenjača.2. Znanstvenici smatraju da su se iz drevnih zelenih algi razvile današnje kopnene biljke. Koja se dva tipa provodnih cijevi nalaze u provodnim žilama lista kritosjemenjača? 226 . 628.3.1. 627. Kako se naziva alga pridošlica u Jadran iz tropskih mora? 627.2. Koji od prikazanih organa pripadaju jednosupnicama? 628. 628. Navedite dvije zajedničke osobine zelenih. smeđih i crvenih algi.4.

Koje aglutinogene sadrži osoba krvne grupe 0? 630. Kakvu tjelesnu simetriju ima organizam označen slovom B? Jednom rečenicom obrazložite svoj odgovor.3. Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4 ) s test-serumima koji sadrže anti-A.1.1. Kojim je slovom označen najrazvijeniji mekušac na slici? Kojoj skupini mekušaca pripada? 629. Navedite dvije uloge korijena. Razgradnjom kojeg spoja nastaje bilirubin? 227 . Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 1? 630.628. odnosno anti-B aglutinine. 630. Slika prikazuje predstavnike mekušaca.2. Koja je krvna grupa „univerzalni primatelj”? 630. Na slikama strjelicom označite stopalo svakog organizma 630.4.2.4.4. 628. Kako organizam označen slovom C uzima hranu? 629. 629.3.3. 629. Koja je razlika u geotropizmu korijena i stabljike? 629.

Navedite puni naziv hormona koji izlučuju jajnici.3. 631.4. 631.631. Slika prikazuje unutarnje ženske spolne organe.2. 228 . Jednom rečenicom objasnite zašto propadanje žutog tijela u jajniku ima za posljedicu pojavu menstrualnog krvarenja? 632.1. Navedite puni naziv hormona koji oslobađa adenohipofiza a djeluje na jajnike. 631. Na shemi je nedovršen prikaz razina koje rezultiraju izlučivanjem spolnih hormona u žene. Dopunite shemu tako da na prazne crte upišete pune nazive odgovarajućih hormona. Kako se naziva struktura u jajniku u kojoj sazrijeva jajna stanica? 631.

633. 633. 632. Navedeni niz kodona na mRNA nosi uputu za neki peptid. Kako se naziva veza kojom se povezuju aminokiseline? 633. Slika prikazuje niz kodona na mRNA. Kako se naziva triplet na tRNA koji je komplementaran kodonu u mRNA? 634. Slovo D označava dugu dlaku a d kratku.1. Slika prikazuje par homolognih kromosoma tijekom mejoze. dok E označava crnu boju dlake a e bijelu. Na kojem se dijelu maternice najčešće razvija? Koja je najpoznatija metoda koja doprinosi ranomu otkrivanju ovoga oblika raka? 632. Kako se naziva faza menstrualnog (ovarijskoga) ciklusa u kojoj je endometrij maternice najrazvijeniji (najdeblji)? 632.3. Navedite dvije mjere koje smanjuju rizik obolijevanja od spolno prenosivih bolesti. Uz pomoć tablice napišite redoslijed aminokiselina u tom peptidu. 229 . Kako se naziva proces u kojem se aminokiseline povezuju u protein na ribosomu prema redoslijedu zapisanom u mRNA? 633.4.2.3.632.2. 633. Na kromosomima je naznačen položaj alelnih gena za dvije osobine dlake neke životinje. Karcinom maternice je jedan od najučestalijih karcinoma u žene.1. Kojim je slovom na slici označen jajovod? Navedite dvije uloge jajovoda.4.

Prikažite sve moguće genotipove njihove djece za navedena svojstva.1.1. 635. Napišite sve moguće genotipove gameta koje će nastati na kraju II.4. Kolika je vjerojatnost da navedeni bračni par dobije sina daltonista koji je istodobno i nositelj gena za albinizam ? Vjerojatnost izrazite razlomkom.3. 634. 230 .2. mejotičke diobe ako se dogodio krosingover na način prikazan na slici. 635. 635. Aleli koji određuju normalnu pigmentaciju kože (A) ili albinizam (a) dolaze na jednom od parova autosoma.634. 635. odnosno tablicu križanja. 635. mejotičke diobe u slučaju da se nije dogodio krosingover.4. Napišite genotipove Katarine i Luke. Katarinin otac je daltonist i albino. Napišite genotipove gameta koje bi nastale na kraju II. Kakav će biti fenotip jedinke genotipa ddEe? 634. Katarina i Luka su supružnici normalne boje kože koji normalno raspoznaju boje. Aleli za normalno razlikovanje boja (XD ) i daltonizam (Xd) su spolno vezani geni.3. 634. Lukini roditelji su zdravi homozigoti. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA. Napišite moguće genotipove gameta Katarine i Luke za navedena svojstva.2.

Jednom rečenicom objasnite razlike u boji krzna lisica koje žive u različitim geografskim područjima. Koji je član hranidbenog lanca mesožder i potrošač drugoga reda? 231 .4.1. Slika prikazuje glave lisica koje žive u različitim geografskim pojasevima. 636. Umjereni pojas:__________ Polarni pojas: __________ Pustinjski pojas: __________ 636. 637.1. Navedite dvije promjene u ekosustavu koje mogu dovesti do smanjenja populacije polarnih lisica. Slika prikazuje prehrambeni lanac u moru. Koji članovi lanca prikazanoga na slici imaju najveću biomasu i količinu energije a koji najmanju? 637.636.3.2. 636. 637. Kojemu geografskom području pripadaju lisice sa slike? Na praznu crtu upišite slovo kojim je označena odgovarajuća lisica. Koji abiotički čimbenik utječe na veličinu uški lisice u različitim područjima? 636.2.

a slika B.2. 639. Slika A. Kako se naziva vrsta prijenosa kroz membranu koji prokazuje slika? 638. istu stanicu nakon nekoliko minuta.4. u odnosu na kap vode? 638. Jednom rečenicom objasnite zbog čega se dogodila prikazana promjena. 232 . Što se dogodilo sa stanicom dok je stajala u kapi vode (slika B. prikazuje stanicu u trenutku kada smo je stavili u kap vode.3. Kakva je citoplazma stanice na slici A.4. Kako će se povećanje biomase fitoplanktona odraziti na biomasu svih ostalih članova lanca? 638.3.637. 638. Slika prikazuje stanicu u jednoj fazi mitoze.)? 638.1. Kod kojih se sve članova lanca prikazanih na slici odvija sekundarna organska proizvodnja? 637.

4.2.2. Koji se organel životinjske stanice tijekom evolucije najvjerojatnije razvio iz aerobne bakterije. Slika prikazuje životinjsku i bakterijsku stanicu. Koliko će kromosoma imati svaka stanica-kći. nastala diobom stanice koja ima 48 kromosoma? 639.3.4.639.3. Kako se naziva tvorba koja je na slici označena slovom A. 640. Navedite dvije zajedničke strukture prokariotske i životinjske stanice. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva. 640. 640. Jednom rečenicom objasnite razliku u građi metafaznih i anafaznih kromosoma u mitozi. Koja je molekula nositeljica nasljedne upute u bakteriji? 640. Navedite dvije osnovne razlike u građi prikazanih tipova stanica. 640.1.? 639. 639. 233 .1.

Slike prikazuju šest predstavnika jedne skupine algi: volvoks. a inače je normalni simbiont u ljudskim crijevima? 641. 642. 641. Bolesnik se liječio antibioticima. 234 . Koja je bakterija mogla izazvati ovakvu zarazu. Slika prikazuje promjenu broja bakterija u urinu bolesnika. 641.2. klamidomonas.641.4. jadranski klobučić.3.1. Kako se naziva prvi antibiotik koji je korišten za liječenje ljudi? Imenujte znanstvenika koji ga je otkrio. Proučite sliku i odgovorite na postavljena pitanja. morsku salatu i spirogiru. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u urin u nakon 16. Koliko je dana prošlo od infekcije do početka djelovanja antibiotika? 641. dana. kaulerpu.

Alge su značajne za život u vodenim ekosustavima.3.4.3. Slika prikazuje životni ciklus paprati. Jednom rečenicom objasnite koje je značenja volvoksa za evoluciju.642.______________________________ D.2.______________________________ F._______________________________ 642. Kako se naziva gametofit papratnjača? 643. Imaju li stanice tvorbe.2. 643. 643._______________________________ E.4. Na praznu crtu uz slova kojima su označene alge na slici upišite odgovarajuća imena algi. A. Kojoj skupini algi pripadaju prikazane vrste? 642. Jednom rečenicom objasnite zašto je tijekom evolucije kopnenih biljaka došlo do redukcije spolne generacije? 235 . koja je na slici označena slovom B.______________________________ B. 643. 642.1. Navedite dva razloga koja podupiru ovu tvrdnju._______________________________ C.1. Kako se zove nespolna generacija paprati? Kojim je slovom označena slici? 643. haploidan ili diploidan broj kromosoma? Jednom rečenicom obrazložite svoj odgovor.

3. odnosno anti-B aglutinine.1. Koja se krvna grupa smatra„ univerzalnim davateljem”? 644. 644. 236 . Koje aglutinine sadrži osoba krvne grupa AB? 644.644. Što su po kemijskom sastavu aglutinini i aglutinogeni? 645. Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4) s test-serumima koji sadrže anti-A. Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 4 i zaokružen? 644. Slika prikazuje probavni sustav čovjeka.2.4.

Na slici označite žučnu vrećicu.1.4.4. Kojim je slovom na slici označen spolni organ u kojem se događa oplodnja? Kako se naziva taj organ? 646. 647.3. Kako se naziva enzim pomoću kojega se replicira (udvostručuje) DNA? 647. 646. U kojem se dijelu interfaze događa replikacija (udvostručenje) DNA? 647.2. Slika prikazuje unutarnje ženske spolne organe. Niz baza na lancu DNA je sljedeći: 647. Navedite tri spolne zarazne bolesti.1. Napišite niz baza na komplementarnome lancu iste molekule. Napišite niz baza na mRNA koja nastaje transkripcijom zadanoga niza: 237 . Kako se naziva organ koji svoje probavne enzime izlučuje u dvanaesnik? Kojim je slovom označen na slici? 645. Koja je uloga žuči? 645.3.2. Kojim je slovom na slici označena maternica? Koja je uloga maternice? 646. Koja je uloga crijevnih resica u tankome crijevu? 645.1. Kojim je slovom na slici označe jajnik? Navedite dvije najvažnije uloge jajnika. 647.3.4.645.2. 646. Koji je najčešći uzrok ciroze jetre u razvijenim zemljama? 646.

Jednom rečenicom objasnite što su homologni kromosomi. Prikažite moguće genotipove njihove djece za navedena svojstva.3. mejotičke diobe ako se dogodio krosingover na način prikazan na slici. Slika prikazuje par homolognih kromosoma tijekom mejoze. 649. Napišite sve moguće genotipove gameta koje će nastati na kraju II. Marta i Petar su zdravi supružnici i imaju dvoje djece. a Petar krvnu grupu 0. 649.0) koji dolaze na jednom od parova autosoma.3. 648. odnosno tablicu križanja. Kako će izgledati fenotip sljedećeg potomka: eeFf 649. 649.1.4. Marta ima krvnu grupu AB. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA. 648. dok slovo F označuje dugu stabljiku.4. Na kromosomima je naznačen položaj alelnih gena za dva svojstva neke biljke. a f kratku. Slovo E označuje crvenu boju cvijeta. Napišite genotipove Marte i Petra.2. Martin otac boluje od hemofilije. 648.2. Kolika je vjerojatnost da Marta i Petar dobiju zdravoga sina krvne grupe B? 238 .B. a krvne grupe određuju aleli (A. 649.648. Napišite moguće genotipove gameta Marte i Petra za navedena svojstva.1. a e bijelu. 648. Aleli za hemofiliju (Xh ) i normalno zgrušavanje (XH) su spolno vezani geni.

.3.. C. 239 .1. i B. 650. 651. Iz koje su se skupine (razreda) kralježnjaka razvile današnje ptice i sisavci? 650.1. označena su krila različitih životinja.? Upišite slova na karti svijeta u dvama od ponuđenih četiriju kvadratića. a nemaju ih današnje ptice.650.4. Kako se nazivaju organi različiti po postanku koji obavljaju sličnu funkciju? 650. B. Slika prikazuje dva odrasla primjerka pingvina vrste A. 651. Na slikama A. Iz kojeg tkiva/organa nastaju krila kukaca? 650.2. Navedite dvije osobine koje je imala praptica (Archaeopteryx). U kojem dijelu svijeta žive prikazane vrste pingvina A. i B.

Jednom rečenicom obrazložite svoj odabir. Pripadaju li pingvini grebenkama ili bezgrebenkama? 652. 652.2. Koji su članovi lanca na slici biljojedi a koji mesojedi? 652.2. Kako će se povećanje biomase zooplanktona odraziti na biomasu riba i liganja? 652.4. Koje ekološko pravilo govori o razlozima različitih veličina tijela srodnih vrsta u ovisnosti o temperaturi? 651.1.3. Slika prikazuje prehrambeni lanac u moru.651. Hoće li biomasa fitoplanktona u moru biti veća zimi ili proljeće? Jednom rečenicom objasnite zašto? 240 . 651.3.

653.4. 653.2.652. Slika prikazuje životinjsku stanicu.4. 241 . Slika pokazuje strukturu molekule ATP-a. Kako se naziva stanični organel u kojem nastaje veliki broj molekula ATPa? 654. Koju ulogu u stanici ima spoj prikazan na slici? 653. Jednom rečenicom objasnite razliku između primarne i sekundarne organske proizvodnje. 653.1. U kojem je dijelu molekule ATP-a pohranjena energija? 653. Navedite naziv jednoga staničnog procesa u kojem nastaje ATP.3.

3. Na slici je pojednostavljen prikaz mejoze. Kako se naziva jedna stanična struktura koju ima životinjska. na slici označen slovom E ? 654. 242 .4. Pretpostavimo da slika prikazuje stanicu gušterače. Kako se naziva stanični organel na kojem će se sintetizirati inzulin.1. 654. Navedite jedan od staničnih organela u kojem se nalaze molekule DNA i kojim je slovom označen na slici.2.654. Na kojoj staničnoj tvorbi nastaju lizosomi? 655. a nema biljna stanica? Uz naziv stanične strukture upišite slovo kojim je označena na slici. 654.

4. Koji je proces u profazi I. U kojim se spolnim organima muškaraca zbiva mejoza? 655. Slika prikazuje umnožavanje virusa u bakterijskoj stanici.3.655.2.4. Pogledajte sliku i ponuđenim opisima etapa u razmnožavanju pridružite odgovarajuća slova. Kojim je slovom na slici prikazana metafaza II.1. najvažniji uzrok genetičke raznolikosti stanica? 656. Kako se nazivaju subvirusne čestice koje uzrokuju bolest stoke „kravlje ludilo”? 243 . Vezanje virusa na površinu bakterije:___ Sklapanje novih virusnih čestica:___ 656. 656. Koji je najpouzdaniji način zaštite od virusnih bolesti? 656.2. U kojoj fazi mejoze dolazi do razdvajanja homolognih kromosoma? Kojim je slovom ta faza označena na slici? 655.? 655.1. Koji je virus označen slovom A na slici? 656.3.

657. Kako se naziva struktura koja obavija tijelo papučice i daje mu stalni oblik i čvrstoću? 657.3.1. Slika prikazuje papučicu.4. Slika prikazuje cvijet kritosjemenjače.2. 244 .657. Kako se naziva struktura koja ima ulogu izbacivanja suviška vode iz papučice i kojim je slovom označena na slici? 657. U koju skupinu praživotinja (Protozoa) pripadaju papučice? 657. Kako se zove „otac mikroskopa” koji je prvi promatrao jednostanične organizme? 658.

245 . Navedite jednu prilagodbu za letenje u građi kostura ptica. Kako se naziva dio cvijeta koji je na slici označen slovom A ? 658. 659.3.1.2. Na temelju izgleda prsne kosti odredite skupinu ptica čiji je primjer kostura prikazan na slici. U kojem se dijelu tučka događa oplodnja? 658.1.658. Preobrazbom kojih organa nastaju dijelovi cvijeta? 659.4. 659.3. Slika prikazuje kostur ptice. Kojim je slovom na slici označena bedrena kost? 659. Navedite jednu zajedničku osobinu ptica i gmazova.4.2. 659. Kako se naziva cvijet koji sadrži i tučak i prašnike? 658.

Pacijentu su dijagnosticirali patuljasti rast. Kako se zove poremećaj povećane koncentracije ureje u krvnoj plazmi? 661. Kojim je slovom na slici označen glomerul i koja je njegova uloga u radu bubrega? 660. Kakva će biti koncentracija mokraće osobe koja je jela pršut nakon otprilike četiri sata u odnosu na osobu koja je jela lubenicu? 660.3. 660. Slika prikazuje osnovnu građevnu jedinicu bubrega. Jednom rečenicom objasnite razliku u načinu izlučivanja egzokrinih i endokrinih žlijezda. 246 . 660.4. 661. 661. Navedite jednu tvar iz koje nastaje ureja ili karbamid.3.2. Liječnik mu je odredio hormonsku terapiju.1. Koji poremećaj nastaje ako se isti hormon luči u prekomjernoj količini? 661. Koja je žlijezda prestala ispravno funkcionirati? 661.4. Navedite puni naziv hormona koji će pacijent morati uzimati.660.2.1.

3. Navedite zametne listiće gastrule? 247 . Upišite riječ „mejoza” i „oplodnja” na za to predviđena mjesta u pravokutnicima na slici.2. 662. Slika prikazuje životni ciklus čovjeka.662. 662.1. Zaokružite na slici haploidnu fazu životnoga ciklusa čovjeka.4. 662. Kako se naziva niz mitoza kojima iz oplođene jajne stanice nastaje blastocista? 662.

a mutant ima crno tijelo (e) i zakržljala krila (vg). Koliko autosoma i koliko spolnih kromosoma ima gameta čovjeka? 664.4. Koje organske makromolekule dolaze u sastavu kromosoma? 663.2.3. 664.663.1. Ove osobine nisu spolno vezane. Kakve će osobine imati potomak sljedećeg genotipa: eevg+vg ? 664. Divlji tip ima sivo-smeđu boju tijela(e+) i ravna krila dulja od tijela (vg+). Prikazuje li slika muškarca ili žene i po čemu se to može zaključiti? 663. 664. Kako se zove znanstvenik koji je započeo istraživanja na vinskim mušicama? 248 . Križana je ženka divljeg tipa za obje osobine i mužjak mutant za obje osobine. 664. Napišite genotip mužjaka.1. Slika prikazuje kariogram čovjeka. Za označivanje osobina vinskih mušica rabe se međunarodno priznati simboli. Napišite genotip ženke ako je za obje osobine heterozigot.4.3. 663. Kako se naziva faza mitoze u kojoj se nalaze kromosomi na slici? 663.2.

665. 665. Kolika je starost Zemlje prema suvremenim procjenama geologa? 249 .3. Na prazne crte upišite slova kojima su na slici označeni glavni dijelovi Miller – Urayeva pokusa.1.4.665.2. 665. Navedite jednu molekulu koja se nalazila u praatmosferi. Slika prikazuje Miller – Urayev pokus kojim je dokazana teorija organske evolucije. Jednom rečenicom objasnite pojam kemijske evolucije. Praatmosfera ___________ Stvaranje vodene pare __________ „Prajuha” ___________ 665.

4. 666. 666. 250 . Navedite jednu prilagodbu na oprašivanje pčelama. 666. Očitajte sa slike temperaturu pri kojoj će se razviti najviše ličinki pčela iz jajašaca. Očitajte sa slike koliki je broj ličinki pčela pri temperaturi od 150C. 666. Slika prikazuje ovisnost broja ličinki pčela izlegnutih iz jajašaca pri određenim temperaturama. Očitajte sa slike temperaturni minimum pri kojem se razvija najmanji broj ličinki pčela iz jajašaca. 667.666.2. Slika prikazuje kruženje vode u prirodi.3.1.

1. Kako se naziva proces kojim biljke vodu iz tla oslobađaju u atmosferu? 667.4. 667.2. Navedite jednu prilagodbu četinjača za štednju vode. Kako se nazivaju najvažniji kemijski elementi koji izgrađuju živa bića i čije cikluse pratimo u prirodi? 251 .3. Kojim procesom površinska voda prelazi u atmosferu? 667.667.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 252 .

_______________________________________________________________________ Odgovori ODGOVORI 253 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 254 .

E. odg. hranidbeni lanac 42. v. organogeneza 69. v. v. krvne grupe 50. v. v. v. v. odg. v. 48. mitoza 8. v. C. odg. A. zigota 25. fotosinteza 53. A. A. v. E. odg. odg. odg. oksitocin 32. testosteron 77. odg. E. B. Graafov folikul 26. bakteriofagi 76. B. A. v. v. fotosinteza i reakcije na svjetlosti 22. prolaktin 30. D. odg. C. odg. v. odg. v. D. A. B. odg. odg. odg. v. odg. odg. v. v. odg. A. odg. D. v. v. B. odg. v. v. odg. hipotalamus 31. D. v. odg. odg. odg. odg. B. D. v. v. odg. v. v. odg. v. odg. C. biosfera 39. v. v. odg. monohibridno križanje s dominacijom 37. D. v. B. odg. v. mejoza I 4. E. lizosomi 12. v. Mendelovi zakoni 70. C. odg. hipotalamus 27. razlagači 40. v. B. odg. v. v. odg. odg. klorofil 64. v. peptidna veza 75. eukarioti 66. monohibridno intermedijarno križanje 71. v. v. odg. fermentacija 15. odg. B. ribosomi 5. C. pasivni transport 61. modrozelene alge 7. v. lizosomi 58. vertikalne zone biosfere 46. dijaliza 11. v. bijelo tijelo 28. odg. Dodatak 2 51. odg. v. D. označavanje nasljednih faktora i generacija Genotip AAbb dati će fenotip u kojem će se izraziti recesivno svojstvo za razliku od ostalih. odg. D. v. v. E. odg. A. v. D. oksitocin 54. B. v. B. B. odg. odg. genetska uputa 33. E. odg. kloroplasti 6. dušikove baze 23. v. odg. Dodatak 2 14. odg. odg. odg. interfaza 13. v. nukleinske kiseline 78. test križanje 35. odg. D. odg. v. v. C. kromatin 10. A. C. gastrulacija 24. E. v. odg. glikoliza 17. E. odg. pokretačke sile evolucije 44. aktivni prijenos 9. gastrulacija 67. primarna organska produkcija 43. C. odg. odg. odg. odg. D. v. v. E. odg. E. v. B. B. C. odg. endoplazmatska mrežica 45. heterozigoti 49. vezani geni 72. E. odg. odg. E. ovulacija 79. C. B. odg. v. odg. odg. označavanje naslijednih faktora i generacija 57. odg. odg. E. v. E. odg. odg. v. E. E. Dodatak 5 56. odg. zakoni nasljeđivanja 36. v. v. A. v. odg. v. v. kloroplasti 74. v. odg. disaharidi 16. v. neurosekrecijski faktori 80. odg. v. B. v. v. areal 41. odg. odg. oksidacija 18. ATP 63. v. D. C. v. odg. D. v. odg. odg. modrozelene alge 73. profaza I 55. komplementarne baze 62. E. v. C. odg. v. trudnoća 29. E. odg. žuto tijelo 65. C. v. C. ATP 21. blastoporus 68. v. odg. odg. C. odg. C. C. v. D. v. odg. enzimi 52. laktoza 60. D. v. D. trofoblast 2. sinteza proteina 34. dihibridno križanje s dominacijom 47. v. enzimi 20. C. biljni virusi 19. v. v. citologija 59. tundra 38. gonadotropni hormoni 255 . odg. D. E._______________________________________________________________________ Odgovori 1. A. v. E. mezoderm 3.

odg. odg. v. C. D. odg. odg. monohibridno križanje s dominacijom 104. D. odg. odg. trudnoća 159. odg. odg. v. monohibridno križanje s dominacijom 84. D. odg. odg. C. D. odg. odg. DNA 151. odg. v. D. v. A. v. E. B. monohibridno intermedijarno križanje 140. C. odg. arhenteron 133. B. odg. C. C. vezani geni 105. odg. odg. odg. monohibridno intermedijarno križanje 121. odg. ribosomi 125. test križanje 120. molekularna biologija 147. E. odg. C. v. v. C. C. mejoza 116. vidi DNA 92. v. E. v. odg. v. mutacije 141. odg. odg. C. odg. odg. D. fotosinteza 126. E. odg. D. odg. C. v. odg. proteini 256 . v. B. v. C. enzimi 152. v. proteini 87. odg. E. odg. v. odg. v. odg. v. odg. v. B. odg.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 81. v. adenin 110. v. C. v. D. Dodatak 5 145. timin 89. odg. embriologija 163. odg. v. v. v. odg. karbon 124. dihibridno križanje s dominacijom 160. A. gvanin 149. proteini 86. nukleinske kiseline 91. v. v. v. B. C. membranski proteini 85. odg. odg. fotosinteza 153. E. v. D. dijaliza 129. B. interfaza 108. v. blastocista 82. C. v. odg. v. E. odg. v. mejoza I 132. proteini 165. v. E. pasivni prijenos 95. v. v. ribosomi 107. fenotip 118. odg. odg. D. odg. odg. gastrulacija 135. v. v. C. v. v. v. odg. A. odg. E. D. test križanje 119. nukleinske kiseline 90. prolaktin 136. A. biologija 106. prolaktin 98. blastomere 101. v. v. odg. odg. v. C. C. E. saharoza 111. v. B. v. odg. odg. C. odg. D. odg. D. D. Mendelovi zakoni 138. odg. v. sukcesija 144. E. E. odg. v. odg. blastula 158. test križanje 139. B. A. B. v. ektoderm 134. v. test križanje 103. D. D. v. trofoblast 100. odg. D. v. nukleolus 96. B. v. v. v. D. žuto tijelo 97. odg. v. v. kodon 154. odg. B. odg. odg. v. odg. D. v. B. odg. testosteron 115. v. odg. biomasa 143. v. v. v. v. odg. D. v. odg. enzimi 93. nukleotidi 88. C. odg. test križanje 161. v. v. A. Virchow 156. A. D. odg. odg. v. odg. C. prolaktin 157. proteini 148. v. odg D. odg. C. C. B. koža 130. ovulacija 114. gonadotropni hormoni 155. odg. homozigot 102. odg. v. v. A. v. interfaza 83. v. mezoderm 117. citološke metode 109. A. odg. ATP 128. odg. biocenologija 123. mutacije 122. odg. v. E. odg. v. komplementarne baze 112. v. v. genetska uputa 142. odg. C. v. odg. blastoderm 99. oogeneza 131. v. lipaza 94. nasljeđivanje 137. ATP 113. evolucija 162. gvanin 127. odg. C. D. laktoza 164. nukleinske kiseline 150. odg. v. B. A. odg. odg. v. v. v. odg. prophliopitekus 146. v. C. v.

eukarioti 206. v. relikti 199. v. odg. odg. v. A. v. test križanje i dihibridno križanje s dominacijom 236. v. monohibridno križanje s dominacijom 180. odg. testosteron 176. v. Mendelovi zakoni 194. odg. v. gonadotropni hormoni 221. odg. D. odg. v. v. ATPaza 171. odg. aminokiseline 226. D. D. odg. v. C. C. odg. ekologija 241. D. odg. v. D. v. odg. v. DNA 211. trofoblast 240. 193. v. E. v. B. v. v. v. v. D. v. v. test križanje 232. v. interfaza i jezgra 175. homozigot 230. v. odg. v. E. kloroplasti 208. odg. dihibridno križanje s dominacijom 233. monohibridno intermedijarno križanje 195. odg. eukarioti 167. žuto tijelo 186. odg. v. C. spolno vezano nasljeđivanje 237. odg. v. odg. bakteriofagi 205. odg. odg. genetska uputa 187. RNA 217. v. C. B. v. v. odg. Dodatak 3 225. D. odg. v. v. odg. E. odg. odg. E. C. odg. polinukleotidi 170. genetska uputa i sinteza proteina 189. odg. v. v. zigota 190. nukleoid 183. C. v. v. fenotip 191. C. kromosomska garnitura 235. vinska mušica. odg. D. Dodatak 2. odg. v. odg. v. Golgijevo tijelo 182. odg. v. v. E. v. odg. eukarioti 201. v. DNA 212. odg. E. genetska uputa 227. odg. odg. AMP 172. anatomija 223. C. virusi 239. odg. B. C. odg._______________________________________________________________________ Odgovori 166. B. odg. odg. odg. v. B. odg. A. komplementarne baze 229. v. C. DNA 215. v. odg. odg. odg. kloroplasti 204. odg. v. odg. odg. v. v. odg. dihibridno križanje s dominacijom 197. A. v. D. v. v. E. biljna stanica 207. odg. C. v. embrioblast 178. D. genetska uputa 219. A. v. genetska uputa i sinteza proteina 188. odg. odg. D. v. aktivni prijenos 174. v. v. monohibridno križanje s dominacijom 179. B. odg. v. citozin 214. C. odg. v. E. odg. v. v. adenin 213. v. odg. anafaza I 238. D. D. v. C. odg. NADP 173. D. E. B. E. odg. D. nukleinske kiseline 168. biljna stanica 209. B. označavanje nasljednih faktora i generacija 196. odg. v. C. D. monohibridno intermedijarno križanje 181. odg. E. test križanje 198. v. odg. test križanje 231. v. B. A. odg. odg. E. C. B. citozin 169. D. dihibridno križanje s dominacijom i vezani geni 234. v. odg. v. estrogen i progesteron 222. E. DNA 216. D. C. v. D. v. D. odg. ekologija 224. blastula 220. odg. D. biologija 200. A. B. D. anafaza I 184. v. odg. odg. voda 210. DNA 228. B. odg. v. odg. v. v. C. C. odg. telofaza I 185. ribosomi 203. peptidi 218. v. odg. prokarioti 202. E. C. B. odg. v. v. A. ICSH 177. odg. odg. dihibridno križanje s dominacijom 192. odg. v. odg. C. odg. krosingover 257 .

odg. E. hipoglikemija 315. odg. v. v. vinska mušica. v. monohibridno križanje s dominacijom 299. dušikove baze 274. fiziološka otopina 303. mutacija 243. atavizam 307. B. prokarioti 306. odg. C. prolaktin 247. ribosomi 276. D. endoderm 265. kodon 309. virusi 289. odg. dihibridno križanje s dominacijom i vezani geni 283. RNA 296. odg. C. odg. v. test križanje 280. ekologija 314. v. v. odg. C. v. v. odg. v. odg. ATP 257. voda 294. odg. B. A. odg. odg. E. odg. odg. E. odg. test križanje 267. odg.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 242. D. Dodatak 2 252. mitoza 259. ATP 256. odg. odg. v. odg. v. E. E. v. odg. B. odg. odg. stanična membrana 278. mezoderm 263. v. odg. D. B. C. A. E. v. C. odg. LH i LTH 246. odg. v. odg. odg. odg. v. odg. proteini 295. odg. test križanje 266. odg. odg. B. v. E. v. E. v. križanac 292. kromosomska garnitura 250. v. v. odg. C. D. odg. Golgijevo tijelo 291. v. B. v. v. odg. v. autoradiografija 273. v. steroidi 316. odg. odg. B. odg. Dodatak 2 249. odg. polifenilalanin 311. nukleoidi 261. aleli 288. odg. D. čovjek. odg. v. A. v. odg. B. odg. C. E. pričvrsnica 260. C. odg. dihibridno križanje s dominacijom 287. odg. B. FSH. v. odg. E. blastocel 262. biomasa 304. mutacije 298. odg. E. fenilalanin i genetska uputa 270. C. označavanje nasljednih faktora i generacija 301. D. v. A. v. odg. v. kariotip 302. v. v. B. D. Dodatak 2 254. D. C. v. vinska mušica. v. v. C. E. v. v. B. v. v. tripanosoma 293. odg. odg. rudimenti 308. spolno vezano nasljeđivanje 284. genetske karte 305. dihibridno križanje s dominacijom 300. odg. odg. recesivno svojstvo 279. C. dihibridno križanje s dominacijom 282. odg. C. odg. odg. v. v. v. v. spolno vezano nasljeđivanje 248. odg. evolucija 272. v. odg. odg. odg. D. v. histologija 313. v. odg. v. E. v. Fleming 244. D. v. odg. živa bića 290. E. v. D. v. C. v. B. B. odg. fiziologija 271. vezani geni 255. C. odg. odg. sinteza proteina i genetska uputa 312. C. odg. vezani geni 281. E. odg. D. v. C. E. E. odg. v. odg. B. D. RNA 277. test križanje 286. E. odg. E. v. odg. sinteza proteina 297. poliU 310. v. dihibridno križanje s dominacijom 269. homologni kromosomi 245. v. v. E. odg. v. v. v. v. v. v. odg. E. D. v. v. v. Hooke 258. monohibridno križanje s dominacijom 268. B. B. v. v. aminokiseline 258 . A. v. v. Dodatak 2 253. kromosomska garnitura 285. E. ektoderm 264. odg. odg. odg. Golgijevo tijelo 275. kromosomska garnitura 251. v. v. E.

odg. v. kromatin 357. ekosustav 392. v. dihibridno križanje s dominacijom 329. odg. D. Mendelovi zakoni 330. odg. E. v. označavanje nasljednih faktora i generacija 350. odg. odg. v. vezani geni 324. B. odg. odg. v. v. v. odg. B. v. odg. trofoblast 374. E. modrozelene alge 328. odg. embrioblast 333. v. vinska mušica. v. B. v. Medelovi zakoni 348. odg. A. v. v. v. C. odg. v. E. E. odg. v. odg A. ektoderm 373. v. odg. odg. B. D. v. odg. odg. odg E. A. spolno vezano nasljeđivanje 325. endokrine žlijezde 369. v. B. v. E. nukleoid 365. v. E. homozigot 347. v. D. v. odg. odg. v. C. v. odg. areal 388. E. B. dihibridno križanje s dominacijom 376. lizosomi 354. v. recesivno svojstvo i homozigoti 322. pirimidinske baze 318.odg. odg. odg. v. fermentacija 381. bakteriofagi 332. C. odg. v. odg. kromosomska garnitura 327. v. A. Dodatak 2 362. odg. odg. v. D. odg. mitohondriji 355. odg. odg. D. v. odg. odg. E. odg. A. odg. E. A. C. dominantno svojstvo i označavanje nasljednih faktora i generacija 319. D. v. biologija 367. ATP 334. odg. C. vezani geni 363. mezoderm 344. odg. B. neuron 340. odg. australopitekus i dodatak 5 393. E. C. oplodnja 383. životinjski virusi 375. jezgrica 356. telofaza I 360. v. v. centrosomi i diobeno vreteno 378. odg B. mejoza I 331. v. E. v. odg. B. v.odg. odg. v. odg. fenilalanin i genetska uputa 352. A. odg. E. endem 391. v. v. biološki indikatori onečišćenja 259 . v. E. blastoporus 343. E. odg. C. prokarioti 346. B. C. v. A. blastoporus 372. profaza I 370. odg. odg. odg. v. v. v. C. E. B. komplementarne baze i kodon 353. C. test križanje 320. odg. v. odg. v. C. odg. osmoza 368. v. v. E. v. B. D. E. D. odg. C. A. B. odg. C.odg. C. odg. heterotrofi i bakterije 386. C. odg. odg. v. D. D. vezani geni 321. odg._______________________________________________________________________ Odgovori 317. fagocitoza 336. odg. odg. D. jezgrica 338. v. v. spermatogeneza i oogeneza 359. v. B. odg. odg. v. metafaza 339. odg. koža 341. odg. v. v. odg. odg. A. odg. odg. v. blastoderm 371. v. fenološke pojave 387. endoplazmatska mrežica 379. blastoderm 342. test križanje 349. B. anafaza I 358. tundra 385. DNA 337. odg. v. odg. v. odg. A. odg. spolno vezano nasljeđivanje 377. A. bakterije 345. E. v. kloroplasti 366. primarna organska produkcija 390. v. autotrofi 389. spolno vezano nasljeđivanje 326. v. v. v. odg. v. B. oksidacija 335. ektoderm 361. zigota 384. odg. v. v. B. oksidacija 382. v. v. v. E. v. odg. v. v. v. lizosomi 380. E. test križanje 364. krosingover 351. test križanje 323. E. odg. v.

hipotoničan 428. odg. plod 473. B. v. koža 400. E. C. v. B. E. odg. C. v. v. odg. rudimentarni organi 465. v. antropologija 405. v. v. v. odg. E. pteridosperme 470. A. B. odg. implantacija jajašca 422. v. A. v. odg. odg. abiotički faktori 450. E. odg. lišaj 458. v. D. B. v. odg. v. odg. odg. B. pričvrsnica 476. odg. lizosomi i endocitoza 442. odg. v. odg. D. E. odg. B. v. odg. v. bentoska biocenoza 430. krapinski pračovjek 431. v. virusi 477. kultura tkiva 407. eukarionti 441. B. B. C. v. sjemeni zametak i tučak 461. E. v. C. v. v. odg. odg. virusi 408. C. D 478. odg. v. odg. modifikacije 452. v. hipertoničan 424. E. C. v.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 394. krapinski pračovjek 433. v. v. odg. odg. odg. odg. prokarioti 410. odg. odg. steljnače. v. E. odg. odg. prirodni rezervat i dodatak 4 436. odg. odg. odg. osmoza 412. A. prijelazni oblici 463. v. bakterije 409. v. v. odg. D. autosomi 475. odg. D. v. vitamini 443. A. A. patogene bakterije 427. virusi i dječja paraliza 437. plazmoliza 479. D. odg. E. leukoplasti 457. natalitet 425. eritrocit 434. E. menstrualni ciklus 445. v. odg. bakterije 440. odg. bičaši i kremenjašice 466. T. v. v. D. v. v. D. C. odg. odg. A. B. limfa 421. v. odg. v. dvosupnice 462. odg. alge 435. B. v. v. odg. patogene bakterije i upala pluća 418. v. B. A. odg. odg. C. A. v. vertikalne zone biosfere 395. v. E. odg. disanje 419. v. A. v. v. v. v. odg. v. v. C. B. D. hranidbeni lanac 417. Morgan. prokariotska stanica 454. odg. C. E. B. mutacija 404. steljka i alge 468. A. E. odg. D. dvosupnice 472. endocitoza 456. odg. odg. B. v. odg. odg. odg. odg. virusi 448. D. B. odg. odg. odg. C. v. biocenoza 413. B. C. sekundarna organska produkcija 415. odg. v. mitohondriji 420. v. v. kremenjašice 467. odg. odg. C. odg. v. C. v. v. 406. saprofiti 455. odg. v. v. v. Homo sapiens 451. v. v. D. odg. živi fosili i ginkgo 447. bakterije 439. bakterije 402. v. C. odg. E. v. odg. D. v. hranidbena piramida 416. v. neandertalski pračovjek i dodatak 5 446. v. odg. C. C. D. mahovine i prokličnica 459. D. protalij 469. D. odg. v. odg. bakteriofagi 396. Escherichia coli 397. živčana stanica 423. v. odg. v. A. B. odg. v. fotosinteza 449. vegetacija 474. patogene bakterije 403. odg. v. C. B. homologni organi 464. v. B. A. odg. B. C. sorus i paprati 460. E. odg. B. fenotip 398. E. odg. odg. v. v. odg. A. odg. v. A. ekosustav 432. areal 426. virusi 401. odg. populacija 429. herbivori i heterotrofi 414. mutacije 399. odg. odg. v. mitohondriji 411. bakteriofag 438. protalij 480. kritosjemenjače 260 . v. plazmidi 453. odg. v. prašnik 471. odg. odg. v. odg. v. v. odg. odg. v. v. odg.

v. v. 21 sadnica 555. odg. v. odg. odg. odg. v. hemoglobin 550. E2 536. E. B. odg. C. glikogen 506. v. v. A. v. C4. D. odg. v. odg. odg. v. drift 527. v. C. v. plošnjaci 542. jetra. odg. E. v. A. B. A. odg. C3 538. viroidi 495. odg. odg. homeotermni organizmi 531. B. C. v. v. v. odg. odg. odg. E. D. odg. krvna plazma 519. odg. odg. odg. D. odg. v. odg. odg. v. fotosinteza 500. odg. v. populacija 513. B. odg. odg. D2 535. D. puči 553. škrob 522. v. B. 557. odg. v. v. B4. odg. odg. odg. A. A i C. raznožavanjem. katabolizam 501. B3. v. odg. v. odg. višestanične životinje 517. odg. mahovine. prašnik 543. v. odg. odg. virusi 494. odg. fermentacija 546. Ivo je zoolog. vidi bubreg 521. odg. odg. fotosinteza 541. v. srce 551. D i E. partenogeneza 558. zaštita okoliša 512. fototropizam 502. odg. B. giberlini 547. odg. A. odg. v. v. mutacije 492. oksihemoglobin. odg. probava 559. v. v. odg. leukociti 518. srce 532. A i D. v. odg. A3. C. A i C. B4. E. A i D. B i D. D. B. ugljikohidrati. B. papratnjače 530. odg. stanična membrana 524. v. v. D5. pubertet 507. odg. v. endokrine žlijezde 514. D. v. C1. krosingover 488. odg. vegetacija 498. sisulja (haustorija). A. kemoautotrofi 545. A. v. v. v. v. odg. B i E. v. osmotski tlak 560. D2 534. v. bakterije 497. v. v. odg. v. B. D3 537. RNA 526. Jura je ekolog. v. odg. odg. v. C. B1. relikti 484. v. v. odg. biljni hormoni. razvoj čovjeka i dodatak 5 261 . odg. v. termoregulacija 508. D i F. odg. odg. D i G. v. odg. haustorije 539. populacija 540. odg. B. glavonošci 544. spermatogeneza 549. E. v. odg._______________________________________________________________________ Odgovori 481. odg. odg. odg. odg. v. rudimenti 491. A i C. psilofiti 483. v. kriptorhizam 504. v. odg. v. centriol 499. hranidbeni lanac 552. vegetativno razmnožavanje 505. spolna određenost potomaka 489. v. odg. kambij 493. antibiogram 561. B i D. flora 487. Krebsov ciklus 523. D. odg. A4. probavni sustav 520. C. C. gonadotropni i spolni hormoni 564. odg. v. bubreg 562. A i D. A2. v. odg. odg. enzimi. v. B. virusi 496. odg. v. glikoliza 563. odg. C. oligomeria 529. gmazovi i kralježnjaci 548. v. A i D. odg. E. D. v. v. Vlado je genetičar. odg. C. C i E. nitrifikacija 503. mahovine 486. hormoni 515.C1. v. odg. v. C. C i E. klica 490. B. C. E. regeneracija 528. B i C. E. v. B. Božo je mikrobiolog. C. A i C. odg. E. odg. v. sedrene barijere 482. A3. v. neuron 554. v. odg. v. B. odg. A i B. paprati 510. odg. korijen. odg. A i C. koacervati 509. B1. 7 cvjetova 556. odg. C. C. v. C. ekosistem 516. dojenje 533. osmoza. C1. v. odg. fotosinteza 525. odg. v. v. jednosupnice 485. A2. C i D. B i C. odg. odg. v. B.

v. bakterije 603. 26. neurohormoni 592. odg. 24. 8. 3. odg. F i G. sisavci 574. fotosinteza 572. 11 miševa 580. nitrofiksacija 578. antikodon 596. C. a zec ne jede skakavce. 10. v. x(G) 24 % x(A) 21 % x(C) 20 % x(T) 35 % 582. v. B i C. inzulin 570. 18. C i F. odg. B. v. odg. odg. odg. glikoliza 594. odg. C. 40. odg. v.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 565. v. odg. saprofagi 575.9445×105 mL) 586. C i E. v. v. odg. 35 D) 2. borovi 599. odg. odg. 1760 mušica 579. 32. v. odg. A i D. 3. v. gljive 566. 8. B. v. odg. v. oblići 595. B i C. 1/16 (0. hidatode 593. odg. nacionalni parkovi i dodatak 4 576. B. A) 2. C i E. v. skuša ne jede punoglavce kojih ni nema u moru.5 min×70 mL×70/min = 3.0625) 262 . gustoća populacije 577. odg. 12. 5. odg. v. v. odg. kukci 587. 37 B) 2. bubreg 589. odg. B i E. odg. odg.C i E. E i F. C i D. onečišćenje voda 602. hranidbeni lanci 597. B. odg. odg. odg. svitkovci 585. v. 17 583. odg. v. D. bubreg 590. B. bakterije 601. odg. D i F. C. odg. nastije 605. odg. D i F. v. A i C. B i D. v. 8. B i C. v. v. kambrij. odg. odg. srce (80. v. spolni hormoni 571. jednosupnice 600. C.. odg. 6 dana 581. odg. odg. svitkovci 568. kliještari 588. A i E. odg. endokrine žlijezde 569. v. dormancija 573. B. v. mahovine 584. odg. borovi 567. 15. v. A i B. v. odg. v. odg. B i E. v. v. 17. odg. v. A. B. odg. odg. v. odg. v. dodatak 5 591. C i E. v. 72 C) 0. HIV 598. 5. viroidi i prioni 604.

23 = 8. v.bakterije 607. Escherichia coli 608. tučak.4. v. latice. peptidna veza 606.2. bakterije 607.1. v.3. Odgovori : 606. aminokiseline 606. v. aminokiselinama. jednake su (klonovi).Odgovori na pitanja otvorenog tipa 606. Odgovori: 607. proteini. E.protein ili bjelančevina. Odgovori: 608.1. v. i 7.1. svitkovci 263 .3. v. 608. o fekalnom onečišćenju. v.2. v..4. 8 (osam). Odgovori: 609. U središtu molekule je C (ugljik). coli je simbiont u probavilu . v.3.4. E. cvat je skup cvjetova na istoj cvjetnoj stapci. lapovi. cvat 608.slika 4. dvojna dioba 607. peptidi 607.1.2. cvijet 609. v. bakterije. peptidna veza. 608. prašnici. kockavica. cvat je prikazan na slikama 5.aminokiseline 606. v.

zagrijavanje. mitohondrij. vlastita DNA prokariotskog tipa. v. grkljan (ždrijelo).4.1. stanično disanje . v. Odgovori: 610. 610.amniota i Dodatak 5. kloroplast 264 . svitkovci 609. dišni sustav 610. škržno ždrijelo i živčana vrpca s leđne strane tijela. razvoj zametka izvan vode. ovojnica (dvostruka membrana). iz parnih peraja (prsnih i/ili trbušnih) 609. mitohondriji 611. ošit ili dijafragma. svitak barem u jednoj fazi razvitka. v. stanica 611.lizosomi.4. v. mogućnost umnožavanja neovisno o staničnoj diobi. alveola 610. gmazovi. C. v. golgijevo tijelo 611. v.4. ribosomi. životinjska stanica.1.3. pluća (desno plućno krilo). A. dušnik. lizosomi.2. zbog toga što je u krvi veći parcijalni tlak CO2 nego u alveoli. nastaju na golgijevom tijelu (aparatu). Odgovori: 611.3. B. v. nema vakuole. ptice i sisavci kao prilagodba na kopneni način života tj.3. svojim položajem omogućava promjenu volumena prsnog koša (udisaj – izdisaj) 611. nema staničnu stijenku.2. nema kloroplast.609. mitohondrij. vlaženje i dezinficiranje zraka 610.2. sinteza ATP-a. v. pročišćavanje.

v. slična struktura DNA.1. antibiotici sprječavaju rast i razvoj bakterija. v. bakterije. bakterije.3.4. liječenje bakterioza. Odgovori: 613. mali optok krvi 614. prokariotski tip. srce 614. sprječavaju vraćanje krvi.1. prokarioti 612. penicilijum.612. v. 265 . v.2.1.1. prema mrežastoj nervaturi u listu. v. v. Odgovori: 616. bakterije.2.mješinarke. puči 615. v. slika B – stapčarke. DNA. prokarioti 612. v. vodenu otopinu mineralnih tvari i asimilate (produkte fotosinteze). heterotrofnost. ateroskleroza 615.3. mješinarke. v. ima nukleoid. v. Odgovori: 615.4. zelene plijesni (kistac). rezervna tvar glikogen. v. v. provodno staničje 616. zalisci srčani 614. stapčarke 613. lijeva klijetka. osnovno staničje 615.4. plućna arterija.2.4. u njemu se odvija fotosinteza. Odgovori: 612. list dvosupnice. Odgovori: 614. mali optok. prokarioti 612. v. v. asimilacijski parenhim. hitinska stijenka kao kod člankonožaca. kvasci uzrokuje alkoholno vrenje i pritom nastaje CO2 koji „diže” tijesto. v. transpiracija i izmjena plinova. provodi vensku (deoksigeniranu) krv. kvaščeve gljivice 613. nukleoid ili bakterijski kromosom.2. antibiotik 614. gljive 613. uzrokujući suženje krvnih žila povećava krvni tlak. dvosupnice (osobine dvosupnica) 615. nukleoid 613. nukleoid. Slika A .3.3. v. potrebna je najveća snaga da krv potisne u aortu. nema jezgru niti stanične organele.1.

v. Krebsov ciklus 618. kukci 617. v. artikulacija glasa (govor) 617.3.1. v.4. hitin.2. v. Krebsov ciklus ili stanično disanje.v. nema stadija kukuljice. početna je glukoza a nastaje pirogrožđana kiselina. kemoreceptori 617. v. unutarnja oplodnja i jaja sa zaštitnom ovojnicom.2. v.3. Odgovori: 618.4. glikoliza 618. glikoliza 266 . gmazovi 618. v. u citoplazmi. glikoliza 618.4. kukci 616. preduvjet za daljnju razgradnju šećera. polisaharid – hitin. 617. miješanje hrane.3.1. gmazovima. kukci 616. kukci 616. dobivanje energije.2. v. potiskivanje hrane u ždrijelo. Odgovori: 617.

stežljivim mjehurićem izbacuje vodu. v. kloroplast 622.4. v. koštana srž.1. to je ishodišna skupina za biljni (autotrofija) i životinjski svijet (heterotrofija). v. Odgovori: 619.1. kloroplast 622. v. v. v.3. riža. v.2. F – crvena očna pjega (stigma) je fotoreceptor. stežljivi mjehurići 620.4. hematopoeza 622. škrob 620. koštana moždina.3.2.4. euglena 620. Odgovori: 622. rasprsnula bi se. v. v.škrob 619. Odgovori: 620.2.4. v. α-amilaza (ptijalin). biljne stanice. škrob 619. v. krumpir.3. euglena 620. zbog razlike u koncentracijama u euglenu prodire voda. Odgovori: 621.1. trombociti. v. ptijalin 619. tjestenina …. glukoza.kloroplast i fotosinteza 622. trombociti 621. grana tilakoidi. bičaši 621.1. zgrušavanje krvi. u vodi opterećenoj organskim tvarima.2.3. fotosinteza . v. v.619. v. tilakoidi. očna pjega. ne može. iz modrozelenih algi. cijanobakterija . trombociti 621. eritrociti 621. ako ne obavlja fotosintezu euglena je heterotrofna. škrob. v. simbiogeneza 267 . eritrociti.

smeđe alge. nukleinske kiseline 626. bakterije su postale rezistentne na antibiotik 625. kaulerpa (F) 627.4. v. nitrifikacija. v. provode pravu fotosintezu kojom se oslobađa kisik. v. kromosomska garnitura određene vrste. Escherichia coli.nitrifikacija 626.2. v. venerina muholovka.623. rosika. v. Odgovori : 624. volvoks. crvene alge. smeđe alge. mitoza 624.3. D. gljive. v. D. v. B. hrast.. aminokiselina.4.kariotip 623.dušikove bakterije 626. centrosom.. monera.1. v. Odgovori : 623. A. 626. 12. Odgovori : 627. protista. bjelančevina. papučica 625. nukleinska kiselina. C.2. v.3.3.aminokiseline. Pasteur. životinje.2. Pasteur. v. v. E. v. bolesnik je prerano prestao uzimati antibiotik. biljke. volvoks (B).3. v. pogledaj na graf 625.2. Odgovori: 626. antibiotik.1. E. C. centriol. crvene alge. protisti 624. vrsta 624.2. v. karnivorne biljke 627. u metafazi. zbog odnosa simbioze s dušikovim bakterijama.4. vrsta. v. omogućuje rast organizma.4.3. leukocitima.centrosom 623.4. leukocitoza 625.1. L. izmjena generacija. muhara. spirogira (C). C. proteini. Odgovori : 625. spirogira 627. kromosomi su pravilno smješteni u sredini stanice u ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena. A. Ili 13. zelene alge 268 . zelene alge 627.1. v. metafaza 623. B. v. tvorba diobenog vretena.1. klorofil a (fotosinteza). zec. carstvo 624.L.

korijen 628. puževi 629.4. v. AB. v. pretvara se u bijelo tijelo i dolazi do ljuštenja stijenke maternice i menstrualnog krvarenja.3. glavonošci 629. Graafov folikul. asimetričan je. v. krvne skupine 629. učvršćuje izdanak. v. torzijom tijelo je zakrenuto i nestala je simetrija.F. v. korijen je pozitivno a stabljika negativno geotropna. gonadotropni hormon.glavonošci 629. eritrociti Odgovori : 631. filtracijom vode.3.3.4.2. krvne skupine 629. nema aglutinogena. razgradnjom hemoglobina.B. krvne skupine 629. Odgovori : 629. v. glavonošcima. Odgovori: 628.2. v. A.gonadotropni hormon 631.4. propadanjem žutog tijela prestaje izlučivanje spolni hormona . krvnoj grupi B.1. A.2. traheje. Odgovori : 629. jednosupnice 628. v.jajnici 631.1. v. sitaste cijevi.4.2. opskrbljuje biljku vodom i mineralnim tvarima. v. tropizmi 629. provodno staničje 628.1.628. v. estrogen ili progesteron. v.1. v.3.Graafov folikul 631. žuto tijelo 269 .školjkaši 629. v. v.

Higijena spolnih organa. v.3.4.4. Dihibridno križanje 634. De. Dihibridno križanje i Spolno vezano nasljeđivanje 635. menstrualni ciklus 632. v. genotip. Dihibridno križanje i Spolno vezano nasljeđivanje 635. albinizam. na grliću maternice. Xd A.3. dE. PAPA-test. Dihibridno križanje i Spolno vezano nasljeđivanje 635. v. Dodatak 1. 1. peptidna veza.2. v. Katarinine gamete: XD A.632. v.4.1. PAPA test 632. antikodon. Dihibridno križanje i Spolno vezano nasljeđivanje 270 . upotreba prezervativa pro spolnom odnosu 633. Dodatak 1.1. sinteza proteina 634. oplodnja. krosingover 634. DE. de. antikodon. v.2. v. Dodatak 1. Dodatak 1.3. A. X D a.1.Arg – Pro – Tyr.1. de. Katarinin genotip: XD Xd Aa Lukin genotip: XD Y AA v.2. v. v. v. Odgovori: 634. v. Odgovori: 633. Odgovori: 635.3.4. Met .genotip. prihvaćanje i provođenje jajne stanice od jajovoda do maternice.2. mejoza 635. prevođenje ili translacija. sinteza proteina 633. peptidna veza 633. sekrecijska faza. Dodatak 1. v. jajovod 632. DdEe . kratka i crna dlaka. v. Odgovori : 632. fenotip 634. genetička uputa 633. 1/8 . DE. genotip. Xd a v.

A v.636. v.C. Alenovo pravilo 636. v. bolja prilagodba okolišu.1. hranidbeni lanac 637.4.fitoplankton. prokarioti 271 .1. zatopljenje 637.4. zaštitna obojenost 636. v. centrioli ili centrosom. 1. ribama i lignjama. voda se giba iz područja gdje je ima više u područje gdje je ima manje. bolest. promjena: nedostatak hrane. prokariotska stanice nema jezgru već nukleoid. Odgovori: 639.2.4. v. najveća biomasa . voda (otapalo) se kreće iz područja više koncentracije vode u područje niže koncentracije vode. u zooplanktonu. Odgovori: 636. povećanje biomase fitoplanktona dovodi do porasta biomase svih ostalih članova lanca. pasivni prijenos. centrosom 639. odnosno nema stanične organele. osmoza 638. centrioli. hranidbeni lanac 637. riba. hipertonična. Odgovori: 638.1. anafazni kromosomi su jednostruki (imaju 1 kromatidu). metafazni kromosomi su dvostruki (imaju 2 kromatide).najmanja biomasa . mitoza. v. osmoza 639. profaza. v. Polarni pojas .2. v. povećao se volumen stanice.2. Umjereni pojas .3. svaka stanica-kćer će imati 48 kromosoma. primarna organska proizvodnja 638. v.1. više koncentracije. profaza 639. v. mitoza 639. v. v. hipertonična otopina.2.lignje.3. v. anafaza 640. bubrenje 638. hranidbeni lanac. v. v. 2.4. postupno nestaju jezgrica i jezgrina ovojnica. temperatura.1. osmoza. osmoza. Pustinjski pojas . metafaza. osmoza 638. hranidbeni lanac. abiotički čimbenici.3. sekundarna organska proizvodnja 637. pasivni prijenos. v.B. različita područja različita boja krzna.3. zaštitna obojenost 636. Odgovori: 637. Odgovori: 640. promjena: paraziti. iz kromatina se oblikuju kromosomi.

paprati. krvna grupa 0 jer nema aglutinogena na eritrocitima. Escherichia coli .1. krvnoj grupi A. Volvoks je kolonijalni oblik jednostaničnih algi s podjelom rada i predstavlja prijelazni oblik iz jednostaničnih prema višestaničnim organizmima. v. v. ribosomi. Odgovori: 642. A-morska salata. C-spirogira. 643. v. v. v. prokarioti. simbiogeneza 641. nema aglutinina. protalij 643./ bakterije su postale rezistentne na antibiotik. v. krvne skupine 644.3. pogledaj na graf 641. 8 ili 9 dana.4. citoplazma. v.3.2. nukleoid 640. penicilijum.1. antibiotik. A. paprati 643.1. B-volvoks.3. zbog prilagodbe kopnenom načinu života. Escherichia coli 641. stanična membrana. protalij.3. molekula DNA. zelene alge.2.3. zelene alge 642. bjelančevine ili proteini 272 . haploidan.4. tj oplodnja je neovisna o posredovanju vodom 644. primarna organska proizvodnja. v. zato što ta tvorba (protalij) nastaje iz haploidne spore. v.4. eukariotske stanice 640. volvoks. D-jadranski klobučić. Odgovori: 643./ neredovito je uzimao antibiotik. v. Odgovori: 644. Fleming. 642. alge. krvne skupine 644. Odgovori: 641. protalij. mitohondrij. v./ nastupila je neka nova infekcija 641. krvne skupine 644. E klamidomonas.. 642.640. sporofit . pacijent je prerano prestao uzimati antibiotik.2. paprati 643. v. Alge su primarni proizvođači i čine osnovu svim hranidbenim lancima u vodenim ekosustavima. v.1. hranidbeni lanac. Aleksandar Fleming . penicilin.4. v. F-kaulerpa 642. v. fotosintezom oslobađaju kisik.2.2. slovom A.4. sporofit.

v. slovo D. gušterača (pankreas).3. v. krosingover 648. žučni mjehur. XH B.1. Odgovori: 648. Martin genotip XH Xh AB.2. 648.645. Dihibridno križanje i Spolno vezano nasljeđivanje 649.2. sinteza proteina 648. Odgovori: 645. u S fazi. jajnici. Dodatak 1.1.4. EeFf. povećavaju apsorpcijsku površinu crijeva. duga stabljika. Homologni kromosomi su parovi kromosoma koji su jednako dugački. tanko crijevo.3. komplementarne baze 647. genotip 648. v. v. ciroza jetre 646. EF. u njoj se razvija razvoj zametka (embrio – fetus). bijeli cvijet . polimeraza 647. v. Dihibridno križanje i Spolno vezano nasljeđivanje 649. genotip. gušteračin sok 645. slovom B . sifilis (lues). v. Xh A. AIDS 647. jajovod. gušterača. v. gonoreja (kapavac). ATGCTGCAT. genotip. Dodatak 1. eF. Petrove gamete XH 0. homologni kromosomi. ef. Y0.3. maternica 646. krvne skupine. v.4. izgledom su jednaki i nose gene za ista svojstva. gonoreja. apsorpcija hrane 645. imaju pričvrsnicu na istome mjestu.3. jajovod 646. alkoholizam. v. AUGCUGCAU. sifilis.3.2. proizvodnja jajnih stanica (oogeneza) / lučenje ženskih spolnih hormona (estrogen i progesteron). Martine gamete XH A. upijaju hranjive tvari iz crijevnog sadržaja. v. v.1. v. Odgovori : 646. endokrine žlijezde 646. Odgovori: 649. Xh B. DNA-polimeraza. v. hemofilija. žuč 645. emulgiranje (raspršivanje) masti u sitne kapljice čime se olakšava djelovanje lipazama. Petrov genotip XH Y 00.2. v. slovom C .4. interfaza 647. Odgovori: 647.1. fenotip 649. AIDS (SIDA). v. Ef. slovom A . v. v.2. oogeneza.1. 273 . v.4.

hranidbeni lanac 652. analogni organi. A-uz Čile (pretposljednji kvadratić). v. novočeljuske 652. povećanje biomase riba i liganja. primarna organska proizvodnja. Bergmanovo pravilo. v. kralješnica u repu.3. bliže ekvatoru su manje a vrste koje žive bliže južnome polu su krupnije. mesojedi – riba i lignja v. izvor energije. 650. vrste koje žive sjevernije. najjužniji kvadratić) 651. Pohranjivanje energije. v. U proljeće se očekuje veća biomasa fitoplanktona zbog viših temperatura i više svjetla ( veći intenzitet fotosinteze i veće razmnožavanje). 652.1. vjerojatnost je 1/8. Primarna organska proizvodnja je sinteza organske tvari iz anorganske a odvija se u autotrofnim organizmima (zelene biljke). hranidbeni lanac 652.4. v. Dihibridno križanje i Spolno vezano nasljeđivanje 649.v.1. 653. Dihibridno križanje i Spolno vezano nasljeđivanje 650. ATP 274 . Bergmanovo pravilo 651. pune kosti. Dodatak 1.3. v. v. v.2. zubi u kljunu.4.2. Odgovori: 652.4. kandže na krilima. biljojedi – zooplankton. 650. sekundarna organska proizvodnja.4.3. v. zaliha energije. Dodatak 1. primarna organska proizvodnja. v. v. iz pragmazova. Odgovori: 651.1. grebenkama. analogni organi 650. Odgovori: 653.2. predaka današnjih gmazova. Odgovori: 650. skladištenje energije.1. dok je sekundarna organska proizvodnja ona koja se odvija u heterotrofnim organizmima (životinje). B-uz Patagoniju (posljednji. nastala su iz pokrovnog tkiva (kože). Bergmanovo pravilo 651. v. praptica 651. v.

endoplazmatska mrežica 654. u sjemenom zametku. bakteriofagi 656. pelikula 657. Mitohondrij. kloroplast. list 275 .1. između fosfatnih skupina. kontraktilna vakuola. A.1.4. u sjemenicima (testisima). praživotinje 657.3..4. Glikoliza. svjetlosne reakcije fotosinteze. centrioli 654. cvijet 658.2. mejoza. bakteriofagi 656. disanje. krosingover. 655. v. van Leeuwenhoek. centrosom. Odgovori: 655. kloroplast 654. cijepljenje. imunizacija. mejoza I. imunizacija 656. stežljivi mjehurić 657.3. mejoza I. spermatogeneza 655. v. v. Golgijevo tijelo 655. Krebsov ciklus. fotosinteza 653. anafaza I.1.2. mejoza. Odgovori: 658.. Odgovori: 656.. v. prioni. U vezama između fosfata. mejoza. oksidativna fosforilacija. glikoliza. slovo E. v.1. vrenje.4. v. stežljivi mjehurić. v. u plodnici tučka.3. 658. v.2.653. jezgra.4. dvospolni cvijet. slovo B. centriol. latica ili vjenčić. 655. v. v. v. jezgra. crossing-over. profaza I.2. fag. tučak 658. pelikula. vakcinacija. v. ATP 653. centrosom.4. preobrazbom listova. v. trepetljikaše (Ciliata). hrapava (zrnata) endoplazmatska mrežica (retikulum). mitohondrij 654. Van Leeuwenhoek A. prioni 657. papučica.3. bakteriofag. 656.2. sklapanje i sazrijevanje novih virusnih čestica – D. Odgovori : 657. v. mejoza II. v.3. označena slovom B. v. cvijet 658. v.4. bakterijski virus. v. trepetljikaši.1. v. vezanje virusa na površinu bakterije – B. v. v. cijepljenje. v.2. slovo D. mitohondrij. slovo C ili mitohondrij slovo F.3. na Golgijevom aparatu (tijelu). stanično disanje. anafaza I. Odgovori: 654. v..

prednji udovi preobraženi u krila.1. probavne enzime). glomerul. Odgovori: 659. aminokiseline. v. Odgovori: 661. somatotropni hormon ili hormon rasta. hipofiza. prsni greben. koncentriranija. slovo C. unutarnja oplodnja. gmazovi. gigantizam. v. amniota 660. akromegalija 661. v. proteini.2. adenohipofiza 661. veće koncentracije. lake kosti. antidiuretički hormon 660. hipofiza. filtriranje krvi. grebenke. ptice 659. ptice. v.2.4.1. adenohipofiza 661.1. ptice 659.3. v. aminokiseline 660.4. amniota. letačice.659. v.4. v. suha koža prekrivena rožnatim ljuskama. hormon rasta. Odgovori: 660. slovo A. nefron 660. gigantizam. endokrine žlijezde. šuplje (pneumatične) kosti. endokrine svoje produkte (hormone) izlučuju u krv. nesu jaja. a egzokrine svoje produkte (npr. v.3. v. uremija 661. v. v. ptice. novočeljuske 659. uremija.2. akromegalija. adenohipofiza. probavni enzimi 276 . hipertonična. izlučuju u probavilo.3. novočeljuske.

e+evg+vg. Odgovori : 662.. brazdanje. v. eevgvg. spermatogeneza.3.2. gastrulacija. mejoza I. metafaza. v. mezoderm. blastula. DNA i proteini. kariogram muškarca. i 662.3. vinska mušica. oplodnja. genotip.662. v.4.2. Odgovori: 664. mejoza. spermiji. gamete 664. v. endoderm (unutarnji listić) v.1. po prisutnosti Y kromosoma tj. zigota 662. blastulacija.1. jajna stanica. v. v. genotip 277 . blastoderm 662.4. mezoderm (srednji listić). kromosomi 663. v. ektoderm (vanjski listić). oogeneza. brazdanje. endoderm 663. kariotip 663. ektoderm. metafaza 663. kromosomska garnitura 664. 22 autosoma (tjelesna kromosoma) i 1 gonosom (spolni kromosom) 22 + 1.1. po spolnim kromosomima X i Y v.2. Odgovori: 663.

metan. biogeni elementi. v. fenotip 664. evaporacija. Thomas Morgan 665. „prajuha” C. isparavanje. v. v. mala površina lista. praatmosfera 666. evolucija 665.4.2. Miller. v. puči 667.2.4.3. miris. cvijet 667. prekrivena smolom. Odgovori : 666.3. v. v. boja. četinjače 667.4. crno tijelo i ravna krila dulja od tijela.3. amonijak. 4-6 °C 666.5 milijardi godina. stvaranje vodene pare A .1. Odgovori : 667. v.4. praatmosfera 665.664. transpiracija.. 300 666. Dodatak 3.2. v. 278 . stvaranje složenih organskih spojeva iz jednostavnih organskih ili anorganskih spojeva.S. Odgovori: 665. praatmosfera B . 23-25 °C 666.4. 667.3. približno 4 .1. praatmosfera 665. (igličasti list). v.1. transpiracija. vodena para.

_________________________________________________________________________ Dodatci DODATCI 279 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 280 .

pjegavo = b 281 ._________________________________________________________________________ Dodatci DODATAK 1 U ovom dodatku prikazani su shematski primjeri koji su opisani pod određenim pojmom u Leksikonu. Pod tim istim pojmom svrstani su i u ovom dodatku. smeđa = a za raspored boje: jednobojno = B. DIHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za vrstu boje: crna = A.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ MONOHIBRIDNO INTERMEDIJARNO KRIŽANJE Aleli: za crveno = a1 za bijelo = a2 282 .

_________________________________________________________________________ Dodatci MONOHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za visok rast = A za nizak rast = a 283 .

xx = prenositelji xx = bolesna xx = zdrava muška djeca xy = bolesna xy = zdrava 1. Primjer 284 . Primjer 2.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ SPOLNO VEZANO NASLJEĐIVANJE ženska djeca xx.

Primjer 4._________________________________________________________________________ Dodatci 3. Primjer 5. Primjer 285 .

Aa = testirane jedinke aa = recesivni homozigot AABB.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ TEST KRIŽANJE AA. AaBb = testirane jedinke aabb = recesivni homozigot za oba svojstva 286 .

naborani = g Tablični prikaz F2 generacije VZG VZG VVZZG G 1 VZg VVZZGg 1 VzG VVZzGG 1 Vzg VVZzGg 1 vZG VvZZGG 1 vZg VvZZGg 1 vzG VvZzGG 1 vzg VvZzGg 1 VZg VzG Vzg VVZZGg VVZzGG VVZzGg 1 1 1 VVZZgg 2 VVZzGg 1 VVZzgg 2 VvZZGg 1 VvZZgg 2 VvZzGg 1 VvZzgg 2 VVZzGg 1 VVzzGG 3 VVzzGg 3 VvZzGG 1 VvZzGg 1 VvzzGG 3 VvzzGg 3 VVZzgg 2 VVzzGg 3 VVzzgg 4 VvZzGg 1 VvZzgg 2 VvzzGg 3 Vvzzgg 4 vZG vZg vzG vzg VvZZGG VvZZGg VvZzGG VvZzGg 1 1 1 1 VvZZGg 1 VvZzGG 1 VvZzGg 1 vvZZGG 5 vvZZGg 5 vvZzGG 5 vvZzGg 5 VvZZgg 2 VvZzGg 1 VvZzgg 2 vvZZGg 5 vvZZgg 6 vvZzGg 5 vvZzgg 6 VvZzGg 1 VvzzGG 3 VvzzGg 3 vvZzGG 5 vvZzGg 5 vvzzGG 7 vvzzGg 7 VvZzgg 2 VvzzGg 3 Vvzzgg 4 vvZzGg 5 vvZzgg 6 vvzzGg 7 vvzzgg 8 Brojevima od 1 do 8 označeno je 8 različitih fenotipova F2 generacije. 287 . žuta = z za oblik sjemenke: glatki = G._________________________________________________________________________ Dodatci TRIHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za rast: visok = V. nizak = v za boju sjemenke: zelena = Z.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ VEZANI GENI Aleli: za jedno svojstvo: za drugo svojstvo: dominantni = A. recesivni = b AB = vezani geni ab = vezani geni 288 . recesivni = a dominantni = B.

za bijelu boju krzna = a Potomci genotipa AA i Aa su s crnim krznom._________________________________________________________________________ Dodatci DODATAK 2 U samim opisima pojmova iz Leksikona dana su pravila i rješenja po jedog od tipičnih primjera za svaki pojam. Broj rješenja odgovara broju zadatka. a potomak genotipa aa je s bijelim krznom. Monohibridno križanje s dominacijom gdje je alel za crnu boju krzna dominantan. 13. Aleli: za crnu boju krzna = A. Zato su u ovom dodatku dana rješenja onih zadataka koji su konkretni primjeri pojedinih pojmova. 289 .

Aleli: za jedno svojstvo: dominantni = A.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 50. recesivni = b Križanjem roditelja aaBb i aaBb moguće je dobiti potomstvo s dva različita fenotipa u omjeru 3:1. recesivni = a za drugo svojstvo: dominantni = B. 56. Monohibridno intermedijarno križanje gdje nema dominantnog alela. 290 . Aleli: za crveno = a1. Dihibridno križanje s dominacijom. za bijelo =a2 Križanjem ružičaste (a1a2) zijevalice i bijele (a1a1) zijevalice nastaje 50 % crvenih (a1a1) i 50 % ružičastih (a2a1) zijevalica. U ovom slučaju omjer vrijedi samo za drugo svojstvo koje smo označili B i b. 192.

Dihibridno križanje s dominacijom. Iz odnosa žene normalne pigmentacije (kći. 291 . Aleli: za jedno svojstvo: dominantni = A. Aa). pa tako i njihova kći. recesivni = b Križanjem genotipa Aabb s aaBa dobit će se potomstvo s četiri različita fenotipa. Monohibridno križanje s dominacijom. AA. aa) i žene normalne pigmentacije (baka. aA) i muškarca normalne pigmentacije i istog genotipa (Aa) dobiva se četiri potomka (unuka) među kojima je jedno dijete albino (aa). normalne pigmentacije i genotipa aA. 251. Aleli: za normalnu pigmentaciju = A za izostanak pigmentacije = a U ovom slučaju iz odnosa albino muškarca (djed. recesivni = a za drugo svojstvo: dominantni = B. a ostala su djeca normalne pigmentacije (aA. AA) može se dobiti potomstvo u kojem su sva djeca._________________________________________________________________________ Dodatci 248.

recesivni = c Svo potomstvo dobiveno križanjem roditelja AAbbCC i aaBBcc ima isti genotip AabBCc zato jer svaki od roditelja stvara samo jednu vrstu gameta. recesivni = b za treće svojstvo: dominantni = C.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 252. Aleli: za jedno svojstvo: dominantni = A. Aleli: za jedno svojstvo: dominantni = A. Trihibridno križanje s dominacijom. Trihibridno križanje s dominacijom. 253. 292 . recesivni = c Križanjem roditelja AaBbCC u F1 generaciji nastaju četiri fenotipa u omjeru 9:3:3:1. recesivni = b za tre}e svojstvo: dominantni = C. recesivni = a za drugo svojstvo: dominantni = B. recesivni = a za drugo svojstvo: dominantni = B.

Dihibridno krianje s dominacijom Aleli: za jedno svojstvo: dominantni = A. U ovom slučaju omjer vrijedi samo za svojstvo koje je označeno s A i a. 293 ._________________________________________________________________________ Dodatci 361. recesivni = b Roditelji AaBB i Aabb dat }e potomke čiji je omjer fenotipa 3:1 za jedno od spomenutih svojstava. recesivni = a za drugo svojstvo: dominantni = B.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 294 .

magnezij. U tablici su dani svi elementi koji se javljaju u prirodi.elementarni sastav._________________________________________________________________________ Dodatci DODATAK 3 ELEMENTI. mangan. cink. kobalt. bakar. fosfor. nikal. klor. molibden. bor. dušik. Oni se kemijskim reakcijama spajaju dajući spojeve. sumpor. ugljik. selen. BIOGENI ELEMENTI Elementi su jednostavne čiste tvari koje se ne mogu kemijskim putem rastaviti na druge čiste tvari. krom. kisik. fluor. To su abecednim redom: arsen. 295 . silicij. jod. vanadij. kalcij. natrij. Isp. stroncij. kalij. vodik i željezo. IME aktinij aluminij antimon arsen bakar barij berilij bizmut bor brom cerij cezij cirkonij disporzij dušik europij fluor fosfor gadolinij galij hafnij helij holmij indij SIMBOL Ac Al Sb AS Cu Ba Be Bi B Br Ce Cs Zr Dy N Eu F P Gd Ga Hf He Ho In IME itrij jod kalcij kalij kisik klor kobalt kripton krom ksenon lantan litij lutecij magnezij mangan molibden neodimij neon nikal niobij olovo osmij paladij platina SIMBOL Y I Ca K O Cl Co Kr Cr Xe La Li Lu Mg Mn Mo Nd Ne Ni Nb Pb Os Pd Pt IME praseodimij prometij radij renij rubidij rutenij samarij silicij skandij srebro stroncij sumpor tantal tehnecij telur titan tulij ugljik vanadij vodik zlato željezo živa SIMBOL Pr Pm Ra Re Rb Ru Sm Si Sc Ag Sr S Ta Tc Te Ti Tm C V H Au Fe Hg Od navedenih elemenata dio njih je potreban u izgradnji živih organizama pa ih nazivamo biogeni elementi.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 296 .

kockavica. Nacionalni parkovi 3. Park-šume 6. Trsteno. medvjed. tisa npr. Perivoj Maksimir npr. Strogi prirodni rezervati 2. kanjon Zrmanje i Čikole npr. Pojedine vrste a) biljne b) životinjske BROJ 2 8 6 69 23 72 114 28 44 360 POLOŽAJ Hajdučki i Rožanski kukovi na Velebitu te Bijele i Samarske stijene na Velikoj kapeli Plitvička jezera. Cerovačke pećine npr. Zeleni vir. runolist. Marjan Split. Brijuni. dio Medvednice. Brusnik. Risnjak. vuk. dio Biokova i dio Velebita npr. Lonjsko polje. Hortikulturni spomenici 8. bjeloglavi sup 297 . vidra. Krka i Sjeverni Velebit Kopački rit. Paklenica. Kornati. Spomenici prirode 7. Parkovi prirode 4. Značajni krajolici 9. Opeka Vinica. Specijalni rezervati 5. Zlatni rt Rovinj. otok Jabuka. Gupčeva lipa. Vražji prolaz. jež. Trakošćan npr._________________________________________________________________________ Dodatci DODATAK 4 KATEGORIJE ZAŠTITE PRIRODNE BAŠTINE HRVATSKE KATEGORIJA ZAŠTITE 1. velebitska degenija. Pakleni otoci npr. Modra špilja. Mljet. otok Lokrum.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 298 .

vodeni beskralježnjaci Prokarioti Kralježnj aci Čovjek Beskralježnjaci Biljke Ptice Sisavci Gmazovi Vodozemci Kukci Kritosjemenjače Golosjemenjače Papratnjače Mahovine Gljive Kopnene biljke (psilofiti) Alge 299 ._________________________________________________________________________ Dodatci DODATAK 5 GEOLOŠKA VREMENSKA SKALA I FOSILNI ZAPISI PRVIH POJAVA POJEDINIH SKUPINA ŽIVIH BIĆA Geološki eoni Geološke ere KENOZOIK MEZOZOIK Geološke periode Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon Silur Ordovicij Kambrij Početak (prije milijuna godina) 2 65 120 155 190 215 300 350 390 480 550 2500 4500 FANEROZOIK PALEOZOIK PRETKAMBRIJ PROTEROZOIK ARHEOZOIK Fosilni zapisi prvih pojava pojedinih skupina organizama Geološke periode Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon Silur Ordovicij Kambrij Proterozoik Arheozoik Ribe Eukarioti.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ JEDNO OD MOGUĆIH FILOGENETSKIH STABALA ČOVJEKOVIH PREDAKA KVARTAR gornji pleistocen Homo sapiens Homo sapiens neanderthalensis srednji pleistocen Homo erectus Paranthropus robustus donji pleistocen Australopithecus africanus pliocen Rhamapithecus punjabicus miocen TERCIJAR 300 .

_________________________________________________________________________ Dodatci DODATAK 6 TEMELJNA PODJELA GLJIVA. BILJKI I ŽIVOTINJA GLJIVE (Fungi) Sluznjače Algašice Mješinarke Stapčarke Gljive Lišajevi BILJKE (Vegetabilia) NIŽE BILJKE ILI STELJNJAČE Bičaši Kremenjašice Zelene alge Smeđe alge Crvene alge Mahovine VIŠE BILJKE ILI STABLAŠICE Papratnjače Sjemenjače Paprati Preslice Crvotočine Golosjemenjače Kritosjemenjače 301 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ ŽIVOTINJE (Animalia) JEDNOSTANIÈNE ŽIVOTINJE Praživotinje Bičaši Sluzavci ili Korijenonošci Truskavci Trepetljikaši MNOGOSTANIÈNE ŽIVOTINJE Spužve Plošnjaci BESKOLUTIĆAVCI Žarnjaci Oblenjaci Mekušci Kolutićavci Člankonošci Bodljikaši Žiroglavci Plaštenjaci Svitkoglavci Kružnouste Ribe Vodozemci Gmazovi Ptice Sisavci MNOGOKOLUTIĆAVCI MALOKOLUTIĆAVCI SVITKOVCI Kralježnjaci 302 .

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->